Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1214
Length(NT) : 807
Best Gene Model Blast : Link to GSTUMT00011536001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001540292.1| Score: 553 E_value: 1e-70
KEGG Definition: hypothetical protein
Accession: ang:An18g06520 Score: 504 E_value: 3e-64
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0915 Score: 441 E_value: 1e-44
PFAM Definition: No Hit Found
Swissprot: P38737|ECM29_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0000502 = Cellular component: proteasome complex
GO:0005515 = Molecular function: protein binding
GO:0030163 = Biological process: protein catabolic process

Sequence:
>Contig1214
TTGGCGAGAACAGACAGGTTGAGATTAATTTTGCTACCGGTGAAGCCATT
GCTTGCCTTGCCGGGGGGTGGCAGAGTAAATCTGTTCGTGGAAAGGTTGA
CATTGCAGGATATGAAAATGCAAAGCCTGCTGAGGAATTGGCTAAGTGGA
GGCTAGGAGAAGTTCTGGAAGCAGTACTGGGCAAGGTGTCTGACACAAAG
CCTAGTTTGAGGAAGGCTGTATGTGTCTGGATGCTGTGCTTGTTGGAATT
CTGTGGAGAGGAGCAACAGGTGAAGTCCAAACTTGGGGAAATGCAAAAAG
GATTTAGGGGATATTTGGTAGACAGAGACGGAGACCGCGGCGAGAGGATT
GACAATGGTTTACGAAAAGGGCGAAAAGGAAACTAAAGATGATCTTGTCC
GGAACCTCGTTTCATCCTTCACAGGTGAGAAAACTCGCACCTTGGCCGGA
AATGTATCGGCAGAAACGGAGCTGTTCGAACCCGGAGCCTTGCCAACTGG
GGATGGAAGTATCTCCACCTACAAAGATATTATGTCCCTTGCTTCAGAAG
TGGGTGATCCGAGCTTGGTTTACAAATTTATGTCACTTGCTCGCCATAAT
TCTCTATGGTCTTCACGGGCAGCCTTCGGCCGTTTCGGACTGGGGAGCAT
TCTTTCCTCTTCTGACGTCTTGAAGCACAACCCTAAATTATACCCAAAAC
TTTATCGGTACCGCTTCGACCCTAACCCCAATGTCGCTCGCAGTATGGAA
GACATCTGGAAGGCTCTGGTCGGGAGTGATGAGAGAAATGTCCTGGAAGC
ACAGTTC

Sequences in the Contig:

SY0AAA44YL16FM1 SY0AAB35YG19FM1