Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1213
Length(NT) : 761
Best Gene Model Blast : Link to GSTUMT00010788001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_03468
Accession: ref|XP_001595379.1| Score: 616 E_value: 3e-62
KEGG Definition: hypothetical protein
Accession: ang:An14g01580 Score: 613 E_value: 3e-62
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0153 Score: 493 E_value: 1e-50
PFAM Definition: No Hit Found
Swissprot: Q5AX35|SLT11_EMENI

Sequence:
>Contig1213
TTGGCTTCTTTCCTCCATCACCACCATCGATACTTCTCCTCCTATAGTCT
GCTGATAATAACAAGAGAGAATAAGAATGCCCCCCGCAGGCCCAAAGTCC
GACATCAACCGCTCGGGCTCCGAAGTCACGGACTTCCCAGCCGTGTGCAA
CGACTGCCTCAGCGCAACTGACAACCCATTCATCCAAATGATAAAGGAAG
ATCACGGCATGGAATGCAAGATCTGCACGAGGCCCTTCACCGTCTTTCGC
TGGGCCGCCGACCGCACATCCCGCTTCAAGAAGACAAACATATGTCTAAC
GTGTGCCCGCCTGAAGAATTGCTGTCAATGCTGCATGCTGGATTTATCCT
TCGGCCTGCCGATCGCGGTGCGTGACGCGGCGCTCAAGTTGGTGGCGCAG
GGTCCTAGTTCGGGGATCAACAAGGAGTACTACGCCCAGAACAGTGAGGG
CACGTTGGTAGACGCGCAGGTGCCGGAGGAGTACGAGAAGACGGACGATC
GGGCGCGGGAGTTGTTGAAGAGGTTGGCTGGGAGTGAGCCTTATTACAAG
AGGAGGCGCGGGGGTGGGGGTAATGGTAATGATGGGGAGGGGTCTCGCAG
GGTGGGGCCTGTTAGGAATAGGGGCGGTGGAGGTGGTAGAGGAAGGGGTG
GAAAAGGTCGCGGAGCTCGCTTCCCGGGTGTCAGTCAGATCCCCCCGGGA
CCGATGGACTGGGCTCCCCCGGAAGATACTACAATTACTTCCCTATTTCT
CACAGGGCCAA

Sequences in the Contig:

SY0AAA44YL12FM1 SY0AAB54YM19FM1 SY0AAD59YJ06FM1