Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1212
Length(NT) : 2626
Best Gene Model Blast : Link to GSTUMT00007459001 E-value : 0.0
Numbers of ESTs : 25

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001539789.1| Score: 1113 E_value: 1e-119
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03411 Score: 963 E_value: 1e-102
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2504 Score: 612 E_value: 9e-64
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 341 E_value: 2e-32
Swissprot: Q08268|MCH4_YEAST
Gene Ontology:
GO:0000329 = Cellular component: membrane of vacuole with cell cycle-correlated morphology

Sequence:
>Contig1212
TTGGGAGATCCAGCACCCGTACCAGTGCTTGAGCACTAAAGAACTTTGCA
GTATAATACCGCCCTTCTATACCATTGATATGATAGAAGGTATTAATGTC
ATACGGCAGCATGCCCACAGCCCTCAGCTGAACACCGAACGAAAGAGAAA
GAGAAAACCGCCTTATTCTCCCAAGGTTTTTGATAGGGGGGCAAGCTAGG
GGGAGAGGGGATATGTGTGCTTGGTGGAACGGGGAAGTTTTTGGCTTACG
TTGTGGCACTTTGCTCCGCCGTACCTTGCTTATGCAGATGGGAGTGACTG
GGGACTACCGGTACTGTAGGTATTGCGGACGAATCGGGTATCCTTGAAAG
ATTTTAAGAATTGCACTTGTATAAAGGGAGTGGGTCCGATCTCCGTTGGG
AGAGTATCATAAAGTTTAGCCACTGCTTAGGGCGGTGTTAGGTTAATACC
CTGGTTTCTTCTGCTTCTTTCTTCTTTTCATTTTTTATTTATTTCAAGAG
GGGGGGGTTCGCGGAGGCTTCACCAGCTGTTTGTCAGTCCAGCAAGAGAT
ACCGTTCTAATTCTCTAAGCACGAAATGGACAAAGAGCAAGGCCCCGCTA
ACTCGCCACCAATCCTCGTCATCCCGGATGGGGGCTGCGAAGACCGCAAT
CCACAAGAAACTGACTCTAGCCGGGTGTCTTCGGGGAAGGGTGAAGGATA
TGGGGATGATGTGGAGATAGGGCCCGCGAGGGAGGAATTCAAGAACTTGG
AGAAGCAGCCTGCTACGCTTCCCATCAACGACCCCTCCAGTTTTCCGGAC
GGTGGAGCAGCTGCTTGGCTGTGCGTGCTTGGGGGGTTTGCGGCGTCGTT
TTGCAGTTTTGGTTGGATTAATTGTATTGGAATATTCCAAGATTACTATG
AGGCTAACCAACTTAAAGAGTACTCACCAAGTACCGTCGCTTGGATATTA
AGTTTGGAAACATTTTGTATGTTCTTTCTCGGTCCAGTTATAGGCAAATA
CTATGATGCCTATGGCTCTCGTGTCATATTAGTACTTGGAACTTTCTTCC
ACGTTTTCGGCCTAATAATGACTTCCATATCGTCGAAATATTGGCACTTC
CTTGTATGTCAAGGAATTGTTTCATCTATCGGAGCTTCACTTACCTTCTA
CCCGGCGCTCGGGGATGTCCCTACCTGGTTCTTCAAAAGGAGGGCATTTG
CTTTTGGAGTAGTGGCTTCAGGATCGAGTCTGGGAGGTGTGATTCTACCG
ATTATGATCCAGCGATTGATTCCTCGGGTTGGTTATGGCTGGACAATGCG
CATCACCGCCTTTCTAATCCTCGGAATGATGATCATCGCAAACCTCACTC
TCAGGTCCAGACTTCCGCCAAAGGGTTGGACCCCGTTTAGACCGAGCGAC
TTCCTGAAGCATTTCAAAGAGCTTGGGTACTCCATGTCGATCGCTGCGGC
ATTCTTGTTCTTTTTCGGAATGTTCTTACCGTTCAATTACATTGTTGTCT
CCGCAAGAAGGAACGGGATGTCAGTTTCCCTGGCGAATTACCTCGTTTCC
GTACTGAATGGCACGAGTATATTTGGTCGTATCCTGCCAGGTTGGCTGGG
GGATAAGTTTGGGAGATATAATATGATGATCCTGACAACGGGTGCTTCCG
GAATCCTCGTGTTGGCCCTATGGCTTCCAACGGTGGGAAACCTACCTACT
ATTTTGTTCGTCTGCTTTTACGGATTCACAACAGGCGCTTTTGTTTCCCT
CGCACCGGCTTGTCTGGCCCAGATTTCGGATATCCGGGAGATTGGGGTTA
GAATTGGAGTTATGTTTGCTACGGTGTCTATTGCGGCACTGACGGGTGTA
CCTATCGGCGGTGCTCTAATCGACAGGTACGATGGAGGATTTTTGGGATT
ACAGATATTCTGCGGAGTAACCCTTGTTGCCTCGTCCATTTGTTGGGCGT
TGGCTAGGTGGATTGTTGGAGGGTGGAAGGCGGCCAGAGTTTGAACAAAA
ATCCTTCGTAAAGACTGCTTGGGAGAGTATATAATATTGTGAGTGTATAA
TACGGTATTGCTGTTCGGAAGTCCCCCTCCCCTCCTTTCTTATATACTAT
CTTTTACGCATCGGAATAGAAATACACTTTATGAAATTTCAACGTGACTC
TTGCTTATAAAACCAGTGTTCACAACCACCTCCCCTGATACAAGTATTGT
ATTTTAATTGACGGTCCCGATGAAAACGGAAAAATAGATGTATATGATAA
GAACCTTTGAAGACGGTTCGGAGCTGTGATCTAACTAGACTATGGCCTAC
CGATACTCCGCCGGGGTGGAACTCGTTGAAGTATCAGCCACAACATCTCA
GCGAATCCCGGCTTCTGGGCTACCCGAACGCCACACTTTGACGTCGTTCG
AGCGGTTCCGCGGGCTTTCTGCAGGCAGCTGCGACACAATCAGAAGAGTT
CACGAACTTTCTTTCAACACAAGTTACCGATAGAAGAAGGAACTCATTCG
ACACAATTCCCAGAGCATCCTCGAGAGCAAAGCAAAGCAAGTGACCCTGT
TACAACGCTTAGTCTATCGCCAAAGCTTCCCCCCTCTTGAAAACCCATCA
ATTGATTCACCAGGCGAGTCACGGCT

Sequences in the Contig:

SY0AAA13YA02FM1 SY0AAA13YH16FM1 SY0AAA16YH15FM1
SY0AAA18YP22FM1 SY0AAA18YP22RM1 SY0AAA25YA07FM1
SY0AAA32YE23FM1 SY0AAA38YD18FM1 SY0AAA39YL12FM1
SY0AAA44YK08FM1 SY0AAA47YP09FM1 SY0AAA50YO15FM1
SY0AAA53YO08FM1 SY0AAA54YF14FM1 SY0AAA57YG04FM1
SY0AAA62YH20FM1 SY0AAB11YD07FM1 SY0AAB19YL11FM1
SY0AAB27YC15FM1 SY0AAB27YL11FM1 SY0AAB35YL14FM1
SY0AAB51YP18FM1 SY0AAB55YK12FM1 SY0AAB7YJ16FM1
SY0AAD8YL03FM1