Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1211
Length(NT) : 1017
Best Gene Model Blast : Link to GSTUMT00011236001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_07963
Accession: ref|XP_001240800.1| Score: 412 E_value: 7e-67
KEGG Definition: mannosyltransferase, putative [EC:2.4.1.-]; K05286 phosphatidylinositol glycan, class B
Accession: afm:AFUA_4G09130 Score: 379 E_value: 1e-65
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1771 Score: 387 E_value: 4e-38
PFAM Definition: Glyco_transf_22, Alg9-like mannosyltransferase family. Members of this family are mannosyltransferase enzymes. At least some members are localised in endoplasmic reticulum and involved in GPI anchor biosynthesis..
Pfam Number: pfam03901 Score: 341 E_value: 9e-33
Swissprot: Q4WPG0|GPI10_ASPFU
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig1211
TTGGAATTTATCGTGGATGATCGGCAACTGGTCTGCCATCTCTTTCCTCC
CCTTTATTCCACTTCATCCTATGCTCTGGACAAAAAGGACATACAACACC
TCTCCTGCTGCACCATGTCTCCCAAAAGCCCAGATCCCAGGGTCTTACGC
TTTTCATCTACCTCCTTAATCTTCTTTTCCATTCTCTCGTTTCGACTCCT
GAACGCACTTACTATTCGGACCTTCTTCCAGCCAGATGAATTCTTCCAGT
CACTGGAGCCAGCATGGAAAATGGTATTCGGCGAGGGTTGGCTTACTTGG
GAATGGAAGAACCAATTGAGGTCAATCGCTCACCCAGCACTCTTCGCCGC
GATCTACAAGTCCGTCAACTTTATTAGTAATCTCATTGGATTGCAAACCT
CAACCAAAGCCGAAGTTCTAGCCGTTGCACCCAAAGTCCTTCAAGCGGTT
TTTGCTGCCCTGGGCGATTACTTTACTGCGAAGCTTGCCGGGAAGCTATT
CGGGGGCGCTGCTGGATGGACCAGTGAATTTAGTTATGGTTCAGTGTTGG
CAGTGCGTTCCATTTCTTTTGCTCCACCAGGACGTTCTCGAACAGTCTTG
AGACGAGCATGACTACTACTGCGCTGTACTACTGGCCCTGGCCCCAGCTC
ATTACAAAGGAACGGGGTGCAAAGAGTGTTGTTGTCGAGGGGCAAATTGA
CCGAAAGGAACTTCAACTTTCGCTATTGTTTGCAGCATTTGCATGCATCC
TCCGGCCAACCAATGTCCTAATCTGGTCGAGTTTGGGATTGTTCCTGATC
TACCATAGCAGTTCTCGAGATAGAGTGCGTATTGTCACCGAAGTTGTAAC
AGTAGGATTTACGGCACTGGTATTAAATGCCGTTGCCGACCACCAGTATT
ATGGTGTTTGGACCTTCCCGCCAATGAAGTTTCTTGAGTTTAATCTAGTT
CAAAGCCTATCGGTATTTTATGGGAGCAACCCGTGGCACTATTACTTGTC
CCAAGGGCTGCCACTGC

Sequences in the Contig:

SY0AAA44YK05FM1 SY0AAD34YJ20FM1