Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1210
Length(NT) : 725
Best Gene Model Blast : Link to GSTUMT00011690001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: tRNA-splicing endonuclease subunit Sen2
Accession: ref|NP_001018222.1| Score: 220 E_value: 2e-16
KEGG Definition: hypothetical protein ( tRNA-splicing endonuclease beta chain related protein [imported] - Neurospora crassa OR74A )
Accession: ncr:NCU01115.1 Score: 220 E_value: 1e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q8TFH7|SEN2_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig1210
TTGGGACCAAACCCCCTAACATCAAGGCACTTACCTGGCTTTTGAGATTC
GTCAACTCGGGGTTTTTTTATTCATGGTTCTCTTGATGAGAATACAAAAG
CGGATCTGATGACTAGCTCACCTCCGCTCTCCACTACCGCGCCAACACGA
TACAAGAAACCTAATTATCACCTTCTCCATGCTCTCCCTCTTCCACTTAG
CGTTAGCCCGCTTCCACCATTGATACCACATAACCCGCTCTCTTTGATTC
ATATAATCATTGCGTATCTTTTCCCCTCTAATCCGTCTCATCCTTCACCT
CTACACAGAGGCTTTTTTCATGCTTCTACTAGGTCGGTGCACATCACCGA
TCCAGAGACAATCAAGGCCTTCTGGAATCACGGTTTCTTTGGAAAGGGAA
ATTTGTCTCGTAGTGAGCCTACATGGGTGACACGTAGAAGGCGAGCTTTG
GGGGTGATTGGCCGAGATGAAGCGTTGACAGCGGAAGAAGTTACTGAGCG
ACGCCGAGGGGAGAGAAAAGAGTTCAAAAAGGAGCGTGCTCGACTGGAAA
AAGAGAAGCTTGATAGACAGCTAGCCGAGGAAGGCAAGCTTAACCCGGAG
GGGAATGAGGACCAGGAGGGGACAGGCTCTGGTAGTAGCAGTAGTGCAGC
AAGGGCTGTTCATTTTGCCCCGTTGGAGTCACCTAGTAGTCGGCGGCGGA
GCTTGGAGAGGCCGGTCGCCGACGT

Sequences in the Contig:

SY0AAA44YK04FM1 SY0AAC41YC18FM1