Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1209
Length(NT) : 1245
Best Gene Model Blast : Link to GSTUMT00009421001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001209515.1| Score: 670 E_value: 1e-102
KEGG Definition: peroxisomal membrane protein pex16 (peroxin-16)
Accession: afm:AFUA_1G07610 Score: 651 E_value: 1e-101
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG4546 Score: 191 E_value: 3e-15
PFAM Definition: Pex16, Peroxisomal membrane protein (Pex16). Pex16 is a peripheral protein located at the matrix face of the peroxisomal membrane..
Pfam Number: pfam08610 Score: 647 E_value: 4e-68
Swissprot: P78980|PEX16_YARLI
Gene Ontology:
GO:0005778 = Cellular component: peroxisomal membrane

Sequence:
>Contig1209
TTGGACCAGAACGACTTCAAAATAGCCCAAAAGTTGGTGGAAGGGTACGT
CGGGAAAAAGAAACAAACATCCAGCCATACAGAAAAAACACCTCAAATTC
AAGATCAAAATCTCCGATCGGGAAATCAGAGACATTGGGATGGTCAGTTA
CTGGCCCAGCCCATCCATTCTACACGTAGCAACCCCCCAGCCTATCACGC
TATTCCCCTCCTATAACAATCAATAACCCCTTCCCGTCTCTCTCTCACCG
ATGGCCAGTTTCTCCAAACTACATCCATCCCTCACCATGTACGGCGACTT
CATCACAAAGAACGCTGGCGCTGTCTCCCAGATCGAATCAGCACTACGGT
CGCTGACCTATATCGTACCAGCCAGGTTTAAGGATGTAGAGTTAGCATCT
GAGTCGCTTCATAGCGGCATTCAGATACTTTCGCTTTACCATGACTCGCT
TCTGGCTCGTGCCGTCACGAAGATACCCCCTGGCGTGCAGAAACCATCGC
CACACAATCGTTATACCAAGTTTTGGACACAAAAGAGCCCCGGTTACAAG
AAACTTGCGTTGATCGTTACTATGATACAGTATACCGAGCTACTGTGGGA
GATGTCGGCTAAGAGGAGAGGGCAGAAGATGCGTTGGAGAGCTGTTATTG
TTCTAGAGGCGATAAAAGCAATTTGCCGACTGCTGCTCCTGCGTCTAACA
AACTCACGTCCACTGCTCACACCTCCTCTTCCTGAACGGGAAATTGATCC
CCAGACGCTCGAGGAAACCTTGGGTCCAGAGTCCTCTCCTCCCGAGGAGA
CGTGGAAAATGCCACGCACGGGCCTTTGCCTCCCTTCCCTCCCCGCAACA
AACCAAATCTCGCAATATCTCCTCACAAAGGTCCTCACGGCGGAGGATAT
CAAACCGCCATCACAGCTTCTTCATCGGATTCGCGGCACGGGCTACTATG
CCGAGGTTCTTTACATAATCAGGGGTCATATATGCCCTTGCCATGAAAAA
GTGGGCGCAAGACAAGAAATCGTGGAGGCCTTGGCTCATCGGTTTCAGCT
TGGAGTATGCTGCTCGACAGCTGTCTAAGAGAGACTTTGAGATGAATGTT
CCTGGTGGGATGAAGGGATTGACCGCACTGGAGAGAGAGGAGATGACTAG
GAGAGCATGGGGGATGGGCTGGTGGGGTGTCAGAGGCGCATTCTATGAGA
ATGTTACTGGGCCCTGGTTGAAAGCAATTTCCACCAAACTAGCCG

Sequences in the Contig:

SY0AAA37YJ04FM1 SY0AAA44YJ21FM1 SY0AAA47YL16FM1
SY0AAB23YB03FM1 SY0AAB55YH11FM1 SY0AAC11YA01FM1
SY0AAC12YJ13FM1 SY0AAD36YP06FM1 SY0AAD9YH14FM1