Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1207
Length(NT) : 1190
Best Gene Model Blast : Link to GSTUMT00009422001 E-value : 1e-118
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 139 E_value: 3e-09
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 115 E_value: 2e-06

Sequence:
>Contig1207
TTGGCTCCAACAAGAACTCTCCACTACTTCACAGTAGACTATCCGAGAAG
AACCAACACAGTACAATGAATAGACCAGAGGGGTGTCATTTACCTGATAG
ACTGAGTTCCCCTGTCCCTATTATAGCTAATTTACCCGTTGGAGAAACTC
ATGATCCTCTAGCTAGCAAGTACGAGTATCCCTTGCCACGATCGAATGCC
TAACCCTTTGAGGGCAAACATCTAGTCACGTGCCAATCATTGAGAGTCCA
ATGAACACTCGCAAATCAAATAGAAATAGAAAATAAAAATCTCAAGGAGC
GCTGATCTTTTTTTTTCATTGATCCCGTGGCATCCTGCTACACAAGTCTA
TTCAAACAGTCATGGGGATTCAATACCGGCAGTAACTTAAAAAAAAAAAG
TCGAGCAAGGAGGGGGGAGCTGGGGACGGGGTGAGCAAACCGAACCCTAG
GCCCATCCACACGCACTAGTACATATCTGGAAAAGAGCCAAAATTAATAA
GCGACAAACCTTCTCTGTCTCTTCTCCCACCTTTCAATCTGACGACAGGA
AGTAACTCAACAAACACTCATTCGCCTCCTCCGCAAATTCTCTCCTTGCT
ATTCACACCTGCTCTGCAACTACCACCTAAAGCATAAGCCATCTCGCTGC
ATTTCAATAAACCTCCTCGCTGCGGCAGTCATCTTTCGCCTCGAATCAAC
ATTTCATCAACCATTACTTTGCTCGCCGCCACCTGAATCTTCTCCTCCAC
CCCGATACGGCATCTGCTCGAATTGACTCACCTTAGCGTTTAGGCTTTTT
CCGCAGCCACTTCAACACAGTCGGTCATTGTGGAATAATAAGCCACACCG
ACTGTGTCGTAGTAGCTGCTTTCCTTGGGACCCTGTGGTCCCGAAAAACC
GGCATAATCATGAACAACTACACTGTGGTGCCTGCGGTCCCAAGCAGCAC
TCAACCCCGGGGGAGAAGAGAGGGCGCTGTTGCATATGTTCCGCCTCCGG
CCGTACCAATGGGTCTTGCACCTCAACGCCCAGCGATGCAAGTGCCGTCT
CCCCCGGTCGTTGTTACGTCCTATCCGACACTACCACCCGTTCACCATGT
TCCCCAAGTAGTCCCTCCCCCGCCACCACCACCTCCGCCACCACCACCAC
CGGCACCCGTACAATTCTCTAGGCCGGCACACGTCGAGCT

Sequences in the Contig:

SY0AAA44YJ07FM1 SY0AAC17YD22FM1