Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1206
Length(NT) : 1170
Best Gene Model Blast : Link to GSTUMT00009140001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211405.1| Score: 572 E_value: 7e-57
KEGG Definition: SAC3/GANP domain protein
Accession: afm:AFUA_4G04110 Score: 553 E_value: 6e-55
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1861 Score: 488 E_value: 8e-50
PFAM Definition: SAC3_GANP, SAC3/GANP/Nin1/mts3/eIF-3 p25 family. This large family includes diverse proteins involved in large complexes. The alignment contains one highly conserved negatively charged residue and one highly conserved positively charged residue that are probably important for the function of these proteins. The family includes the yeast nuclear export factor Sac3, and mammalian GANP/MCM3-associated proteins, which facilitate the nuclear localisation of MCM3, a protein that associates with chromatin in the G1 phase of the cell-cycle. The 26S protease (or 26S proteasome) is responsible for degrading ubiquitin conjugates. It consists of 19S regulatory complexes associated with the ends of 20S proteasomes. The 19S regulatory complex is composed of about 20 different polypeptides and confers ATP-dependence and substrate specificity to the 26S enzyme. The conserved region occurs at the C-terminal of the Nin1-like regulatory subunit. This family includes several eukaryotic translation initiation factor 3 subunit 11 (eIF-3 p25) proteins. Eukaryotic initiation factor 3 (eIF3) is a multisubunit complex that is required for binding of mRNA to 40 S ribosomal subunits, stabilisation of ternary complex binding to 40 S subunits, and dissociation of 40 and 60 S subunits..
Pfam Number: pfam03399 Score: 144 E_value: 6e-10
Swissprot: Q32NW2|LENG8_XENLA

Sequence:
>Contig1206
TTGGACTTTCTGCCATCGACACGACCTCCCAACCTAAAGTTGCTTTCTCA
CAGGGTCAGCCAGCTTGATTTCACTAATTTGTCATAATACAGCAGTATCC
GTCTAATTAACCATCCCATCCCGTTCTCCTTTCCAAACTGCCATCCCCAA
ATAATCGACAAACATAAAACATTGACACCATGTCTGCACCACCATGGCGA
TCAGGTGGTACTAACGGAAACAATCGAAATGGTGCGTTTCACTCTGTTAA
TTCTCGCAAGACACTCTCTGGTCGCCCCATTCACCATGACGGCACTCAGA
CTCTTACTCAAAACCCAGCCCCTGAACAAACTCCAAAGACTCAGTTCCCA
GACAAGTTGAAGGATTATGTTGCCCGAACTTTCGAAGATTGCCCACCGGA
CGAGAAGGCTGCTGTCGAGTTAGAGCTCAAGAGAATAATTACAGATGCCT
TTAATGAGAAGGTTGTTTGGAGTTTGGAATGGGATAAGATGCCGCTTCCA
CAAACAATACTAGCAAGGAAGAAGGTGACTGCAAAGGAGGAGCAAACAAC
AAAGACACTTTCTATGAATCGAGTCAGTAACGAAACCAAGGCGTCTCCAG
CTTCCCCCTTCATCCGAAAGCCTAATTACAGTAATGTCATGGACGTGGAC
TATCCTGGAAGAAAGCGCAAAAGTGCCGGCTCTAGTGAAGAATTAACACC
CCCAACCCCAGACAGATTCGAAGAGAGGTTTGACAAGCGACCTCGTCAGG
GTGACAAATTCCTCCCAACATCGGGTAAACTAAGTCAACGTGAAAAGGAT
AAGCGTGCGAAACGGTTTGAGGATGAAAGGCGTGAATATTTGCCCGACTC
GGCCACCCCGGAAGTTCCAGATAACAAGAAGCCCTTGATTGGTCGTTGCA
TGGATTTAGAGAAACGATATTTTCGTCTTACTTCAGCCCCCAACCCAGAT
CATGTGCGCCCATTACATGTGCTTGAGAAGACTCTGGAAATGCTCAAGCG
CAAATGGAGATCAGAAGCAAACTATTCATATATTTGCGACCAGTTCAAGT
CACTTCGACAAGACCTAACAGTTCAGCACATCAAAAACGACTTTGTTGTT
ACCGTTTACGAAATTCATGCGCGGATAGCTTTGGAAAAGGGTGACTTGGG
TGAGTATAATCAGTGTCAGA

Sequences in the Contig:

SY0AAA44YJ06FM1 SY0AAA61YH15FM1 SY0AAB10YO01FM1
SY0AAB17YO21FM1 SY0AAB54YM05FM1 SY0AAC24YC01FM1
SY0AAC41YI24FM1 SY0AAD1YJ15FM1 SY0AAD9YA24FM1