Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1205
Length(NT) : 1450
Best Gene Model Blast : Link to GSTUMT00008862001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1205
TTGGCAAATGGGAACTTTGGAATCACACCTCCGATACCATATGCTCCGGC
GATTGAGAGCACAAAGTCTTCCTCAATCCGCGCTCGAAACATCCTCGACT
TTCCCCCATCCAAGTCCAATCGCGGTGGATTCCCTTGTGGCCCCAACTCA
TAATACCTCGAAACACCTAAACGCTCCGATAAAGAGAGAGCAAGTTCTTC
AGGCGATACTGACGTTGCGTCATCGGAATGGTCGTGGTAGAGCTCGTAGA
CTGTCGATGACGCCGCGACACCTGCGAAACAGGAGACGACGAGACCAGGG
AGAACCCTCATGCCGGGAAACAAAAAGGAAAGAGAAAAGGCTAGAGTTCT
ATTCGCGATGGTGGAAAAAGTGTGTGTTCGTTTAATGGCGTGTTCCAGTG
GGAAGGAGTTTTGGGAGCTAGTAGAAAGGGTGGGTGCGGTTTTCAAAGCT
GCCAGGTCGAGTTATGTTGATGCTGTGATGAGAATTACCTAATCAAACTA
AAGCGAGTGCTGAAAGATACCCTACGGTATCCAGCTGCCCGTGGTGGATT
ATCGATATCTCTTTACTTCCTTCCCCTTCGGTTTCCTTGGGGATCCAATT
TCTTTTTCTTCTTTTTCTTCAAACTTGCAACACTTTCTTTTGCCCCTTCC
CACTTTCTTCTATACATTTACTTTGTTCGATCTAACCAACTCCTCGACTT
CATTTGTTTTTTCCCTTTTAGAAGGGCTCCCTCCTTGCATCCGTAACATC
TGACCTTCCACGCGGCAAAGCTACTATCACGATACTATCATCTTCCATAG
TCTTCCTAACGACTCAGACATCCACCCATCTACCCATCCACCCATCCATC
TCCACCTGCCCCACGACGTGAGCCTTTACAACAGCAAAATTATTAATTTT
TTGAAGGAAAGCACAGCAGTCACCCCCGCGGCACTCCGTGCAATGTTCAA
ATCTCTCCGAACACTTCTATCGTGTTCCCGCTACCCTAGCCGCTTTACGA
ACGACGGTGGCGCAATATACCGCGTGCGCTTCGTCCCTAAAGAACGTCGA
TTCGGCACATTTACTCGAGCAATGATATGGCTTAGCGGATTTCAGCTCGC
GGCGAATGGGCTGCTGCAGATATATGGGAACGGGTGGGAGAATCCAATTT
TTATACCGCTCGGGTTTGCAGAGTTTGTCCCTGAGAGGGAGTATAGCCCC
GATGATCCGGAATATTCTATGTATATGAAGTTTAGGAAGGACCCACAGAG
GGCACTGGAAGGGAAACGAAAGGTCGTCGACGCACTTATCGACTATCTTG
GGAAAAGATATGGAAAAAAGTTTGGCGGTAACATTGAACCTGAGATTGCG
ACCGTATACTATCACTACCCGCTCCGGCCTCGGGAATACAAACGCAAAGG
ACTAAAGATATCCCCACCACCACCACTCCCAGACGACACTCCCCCCCCCC

Sequences in the Contig:

SY0AAA36YE11FM1 SY0AAA44YJ03FM1 SY0AAB31YL15FM1
SY0AAB33YH18FM1 SY0AAC12YO01FM1 SY0AAC8YP05FM1
SY0AAD11YG02FM1 SY0AAD20YN13FM1 SY0AAD23YL10FM1
SY0AAD24YG18FM1 SY0AAD29YP20FM1 SY0AAD41YK02FM1
SY0AAD43YP11FM1 SY0AAD46YB06FM1 SY0AAD50YE09FM1
SY0AAD9YC10FM1