Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1204
Length(NT) : 821
Best Gene Model Blast : Link to GSTUMT00001699001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CHGG_01951
Accession: ref|XP_001221172.1| Score: 212 E_value: 2e-15
KEGG Definition: hypothetical protein
Accession: fgr:FG00691.1 Score: 197 E_value: 6e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1204
TTGGGGTAGTTTGTGTCACAGGGTGCACGTGCAAATATTGAGGCTCAAAA
TACACAGATGGATGCCCAGCGTGACCTCATCTGTCTTTGGTCGGCATTGT
AACTTGTCATAAACCTGTCGAGCTCGACGTCCCCTATCCTGAGCTTCCCA
CCCCCACGGTTATCGACGTTCTTATGACCCAAAAGTCGTAAGAAACCCGG
GAGTTACGATAAGGTATCATACACAAAGTCTACGCGACGATAGGAGGAGG
GGCACCCCAGAGCTCAACCTAGACGGGGGAGGTCTGCTGCCTCTTGGCGA
TCGCGCATCGCACCCCCACAACCCCATCCCCAACACCACCATCGTGAGCA
CTACCAGTGGGGTATGTCATAATACACTTTAACTTACCTTACCACGATAT
AGCTCACCTCGCCGCACCTTTCCGCCATATCCACTGTCCAAAATGCCGGT
TCTCCGCCGCTACTGTCGCGTGTCAAAATACACAGTCCTAGAAGTCCGAA
TTTACCTCGACAATCCGGTCCACCTGCACACCTGGTTACTCTCGCCTCGG
TATAACGTCCTTCCGCGAATATTTCAATCGATCAAACCACATGTGTTACC
GAAGCTCAAGGAAGAGCGTGAGCGTGGGAGTGGTGGGAAAGGCAAGAGTG
CCAAACCAGTTAATGATGTCGTCGTCGAAGACGACTACGAAGTTTCTATA
TTCCTTACGAACTCTGGAACGCGTCACACTGTAATGACGAAACGAAAAAC
GCTTCGGGGTTATACTAGTGGTGGTGAAGTGGGTGGGATGACTGGAGGTA
CTGGGGTGGGGGTCCAACATC

Sequences in the Contig:

SY0AAA44YI11FM1 SY0AAB7YD10FM1 SY0AAC20YM02FM1