Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1203
Length(NT) : 1081
Best Gene Model Blast : Link to GSTUMT00011617001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_07406
Accession: ref|XP_001591959.1| Score: 534 E_value: 2e-52
KEGG Definition: hypothetical protein
Accession: ang:An18g04230 Score: 488 E_value: 2e-47
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2409 Score: 392 E_value: 1e-38
PFAM Definition: No Hit Found
Swissprot: Q09799|KRI1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1203
TTGGGTTTCACCTTTTTTCACAACAAAATCTCCTGCCATAACCATGCCTC
GCCCAAAGAAGGACAAGTCGGATCCTTCTTTTCAGTTACTATCTGAGGAT
CCTACTTCCTCTGAATCCCAGTACCGGCCAATCTTCGGTATCCTTTCTGA
TTCCGAAGATTCGGGATCTGGAGACACCCAAGAGTACCATTCTGCGGCCG
AACTGCCCGATGGGGAGGATGGCCACAAGCTCAGGATTAATAAAGAATAT
GCAAGACGATTCGAATACAACAAGAAGCGCGAGGAGCTTCATCGCTTGCA
AGAAAAATATGGCAATCAGGGCCTAGGAGAGAAAGAGGAAGGCTCGGAGG
AGGAGGAGGAGGAGGAAGAGGAGGACGATACAGCAGTGCTAGCAACAGAA
CGCCTGGATCAAGAAATCGCAGCAACAATCGACGCAATTCGAAAAAAAGA
CCCCAAAATATATGATGGAAAGACAACCTTCTTCTCGGCTGTTGAAGGAG
AGGGAGAACCGGGTGGCAAAGAGGGAATTGAGAGTGAGAAGGAAAGGCCA
ATGTTTTTAAAGGATTATCATCGCAAAAATCTTCTTTCTGGAACCGTCGG
CGATGAAGAGACTCCTATGACTTACTTACAGGAGCAGGAAGATTTCAAGC
GCACGGTCGTTCTTGAGATGCACCAAGCGACTGCGAATGAACCCGATTCT
GATCCCGATGACGCTGACGCAGGTTTTCTGGTCAGGAAAAGGCAACCTGA
GAAGCCTGAGCCTGTTGTGGACATCCCCGATCCAGCCACTGCCGATCCAG
ACAATCCTGAAGAATACCTCACACGTTTCTTTCAATCTCGTGCATGGACT
AAACCAACTGGGTTCATCCCTCTCGAGGATGATGATTCGGGAGAAGAGGA
CTGTATAGAGGAATTCGAAAAAGCGTACAACTTTCGTTTCGAGGACCCTG
ATGCCAATGTCAGAGGTAAATTAATGACCTACGGTCGTGATGCAATTTCG
GCCAATACTGTGAGACGGGGAGAGATATCTGGAAGGAAGAAGACACGTGA
AAAGAAACGGGAAAAGCAACAAGCCGAGAAG

Sequences in the Contig:

SY0AAA44YI10FM1 SY0AAC9YK21FM1 SY0AAD51YN03FM1