Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1202
Length(NT) : 776
Best Gene Model Blast : Link to GSTUMT00003883001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: CDC27, DNA polymerase subunit Cdc27. This protein forms the C subunit of DNA polymerase delta. It carries the essential residues for binding to the Pol1 subunit of polymerase alpha, from residues 293-332, which are characterised by the motif D--G--VT, referred to as the DPIM motif. The first 160 residues of the protein form the minimal domain for binding to the B subunit, Cdc1, of polymerase delta, the final 10 C-terminal residues, 362-372, being the DNA sliding clamp, PCNA, binding motif..
Pfam Number: pfam09507 Score: 119 E_value: 3e-07

Sequence:
>Contig1202
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCACTGCTCTCTCACCCCCT
CCCCACCACTCGACATAAATACCTCTGAGGACCTAATCCTGTTAGAACTA
CTTTCCCCTCTCCCTCTCCCTTCCCTTTCCTCTGCCCCCTTGCATTCTGT
CACTCAACTCCTCTACTTCCCCATAAGACAACCAACCACCAGCACCACCG
CGTGGTACTTGCCCACCAACGCGATAAACACCACCCCACAATTCTCCCCC
ATCCACCAATTCCACTCCAAAAGCACTTGCGAAAATAAACTACGTGCCTC
TGCGTGCCTCCAAAACTCACGCATTGCCAATCTTTTCCTTAAAAAACAAC
TTTGCCTTTCTTTTAAACGCGCAAAAAACACAGATATCCACCCCATCCCC
ACAAAATGAGCGAACCAGTTCTACGTCGAAGCGGACGGAATATCGCAAAG
AAGGAAGCGGCCCCTCCACCCCCTGCACCCGGGCCAGCCCCCAAGAAACG
CGCATCCACGGAGCCTAAGAAGCCTTCCGCGAAAAAGGCAAGAACGGTGG
TCGACAAGGCCCCCACTGTTGTCAAGAATGCCGTAAGTAAGGATAAGGAC
AGCAAGAAGGAGGACGCCAGCAAGAAGAAACCAGAGGGAGAGGCATCCGC
GTCTGCGGCGGCTGCTGAAGTAAAGGCCGCGCCAATTCCGGCGGCAGAAT
CCTCTTCTGCTGCACCGACAGTAACTACTACCATTGTTACTACTACTGCC
GGTACCAAATCTGCCGCTAAGGCGAA

Sequences in the Contig:

SY0AAA12YL12FM1 SY0AAA28YC10FM1 SY0AAA40YG16FM1
SY0AAA44YH20FM1 SY0AAA46YI18FM1 SY0AAB53YH07FM1
SY0AAC4YA13FM1 SY0AAC50YL20FM1