Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1201
Length(NT) : 2550
Best Gene Model Blast : Link to GSTUMT00005681001 E-value : 0.0
Numbers of ESTs : 19

Blast Results:

Nr Definition: MAP kinase kinase (Mkk2), putative
Accession: ref|XP_001265088.1| Score: 1273 E_value: 1e-137
KEGG Definition: MAP kinase kinase (Mkk2), putative [EC:2.7.12.2]; K08294 mitogen-activated protein kinase kinase
Accession: afm:AFUA_1G05800 Score: 1273 E_value: 1e-138
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0581 Score: 852 E_value: 1e-91
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 558 E_value: 2e-57
Swissprot: Q9Y884|SKH1_SCHPO
Gene Ontology:
GO:0030428 = Cellular component: cell septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004708 = Molecular function: MAP kinase kinase activity
GO:0000902 = Biological process: cell morphogenesis
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0006883 = Biological process: cellular sodium ion homeostasis
GO:0000910 = Biological process: cytokinesis
GO:0000165 = Biological process: MAPKKK cascade

Sequence:
>Contig1201
TTGGACCACACCCACCCTACCTATCATAGACCACCTACCGGCACTGCTCC
TCTATCTATCTACCTTGTCCCACCTCCTCCTTCGCCGTCTCCTTCGCCTC
GCTCGCCCCTCGCCTTTTTTCCCCCACAAAAACACCCAAGATTGCATTTC
TCTGGTAAAGCTTCTGTTGGGAGTTTTTCCGCGAGACCTTGAACGGGTCT
CATACCATACTCTCGTGGCAGCAGCTACTACGGCTGATTACAGTATCGGT
CTCCGGTTTATCACACTTTTTCGTTCCTTAATCTCGGTATCTGTTTTGCT
CCTCACGTCCTGTTTACTGTCCCGGTACCTTGACTTGAGCCCTTCCTCGC
CTGAGCACATCATTTGTATCGTCGCTTTGTCGTCGGGCATAACCATCCAT
TTCCCACAAGGCGGGCACCGGTACGTCTATCTTGCCTGTCGAGTACGCCG
ACACGTCGCTCCGACTTCTTTCCTTCAGCCGTCATCCCGAAACGAGGATA
AATAGTCTGAAGAAATCTCACCGGGTCCCTTTCGTTTAGATTTACTTTTT
TGTATTTTTTATTCTCCTTACCAGCCATCTACGTACCCACCATCTTCCTA
ACGTTGCTGTCAATCACCGGAGCAATTAATTACCCTTACAACTATCGATC
TAGATCGCAAAGTAACAACACATTGACGAAAGCTCAACGAGGGGCAATAG
ATAAATTCTCAGGATTGTAATCTTCTGGAGAAAATATTACCCGATCCTTA
CGACCTTTTCCTCCAGGGCACTCTGAACATCGTGGTCACATATCTAGTTT
TTTAACACTCCACTGCCGAACCATAAGGGACTCGGACACCTGCCGTTTTC
GCTATCATAACTACTATCCATGTCGGCACCTGCACAGCTTCTGCGGCCGG
CGAATCCGCACAATGGGCCCAGGGTTCCCCGGCTGGGCCTTTCGATCCCG
CCTCAACCTGGCTCGAGATCCGTCGGTGCTCCCCAACTAGTCGGCCCCGC
ACGTGCCCCCCCTCAGCTACGTCTGGCTACTCCTGGGAATCCTAGTGCCA
ATGGAATTCAACCAGTAGATCAGAGACGGGCGCAGGCATATGCTAGCCCG
GTGAATACCGTTAACAATCAGTACTCGGCTCTGGGTTATGCTATGGGGTT
AAAAAATCAAGTGCGGGGTTCTCCAGAAACTGCTGTTCCACGAATGGCTA
GCCAGGAAGGCGCAAACAAGAAGACTATTGACTGGGACAATGATAATTTA
GACGTGGAGGATCTTGATGATGAGGGGTGGAAGAAGGCCAGTGAGGATGG
GAGGATCGTGGAACTGGGAGGTTTAGGTGAAGGGGCTGGGGGAGCGGTCA
CTCGCTGTATGTTGAAGGGCGGAAAGACGCTCTTTGCTATGAAAATCATC
ACAGCAGATCCTAATCCCGAGATTCGAAAACAAATCTTCCGTGAATTAAG
CTTCAACAAGGAATGTAATTCGCCCTATATCTGCAGATACTTTGGTGCAT
ACACGGATTTATCTTCCGCCACGATTTCCATTGCTATGGAGTTCTGTGAG
GGTGGGAGCCTAGATAGCATTTACCGAGAGGTAAAGAAATTAGGGGGAAG
GACTGGAGAGAAGGTCCTGGGGAAGATTGCTGAAGGGGTGTTGGAGGGGC
TGACGTATCTGAGTGGGAGAAAGATCATTCATCGAGATATCAAGCCATCC
AACATCTTACTGTGCAGAGATGGGCAAGTGAAATTGTGCGATTTTGGTGT
TTCCGGAGAACTCATTGGATCTAAGGGGAATGCGGATACCTTTATTGGCA
CTTCGTACTACATGGCTCCCGAGAGAATCCAAGGATTCTCCTACACCATC
ACCTCCGATGTCTGGTCTCTTGGCGTTACCCTTCTCGAGGTGGCCCAGCA
CCGTTTCCCATTCGGCGAGGAGAGCGACAGTACTAATGCCCGGTACAACC
TTATTGACCTTCTTACCTATATTGTTCAACATCCTATTCCGGAGTTGAAG
GACGAACCCAATCTTAAGATCAAATGGAGTCACAACTTCAAATACTTCAT
CGCTTGCTGTCTCGAAAAGGACACTCAGAGACGCGCCAGTCCATGGAGGA
TGCTGGAGCATCCATGGATTATGGAGATGAAGAATAAGAAGGTCAACATG
GCTAATTTCCTTTCGCAAGTTTGGGACTGGAAATGAGAGGTTGTGTAAGG
TTTCAAAAGTTTTTTTCTGGGGCGCAAAATTGGGAAATGATTTTTCGTGT
TTAAATTAAGGGTGTCCCGCTTAACTATTTGTGAGACGGTAAGAGAATAA
GATATCACTCTCCCGCATCCGGCATAAAGTTTTGCTTGGTTAACTCCCTT
CTCATCTCTATGTTCTTTTCTTTCTTTCCTTTTTTCTTTCCTTCTTTGCT
ATTGGGTTATTTTTTGTATTGCATCAGGATGTTTTTATTTATTTTTTCTA
CCATTTTCTCATGATTTGTGTTTCATGATTGGGGTGAGAGTGGGGGAGAC
TCTTAGGGGGTCTGCAGCAGTCTAGAAATAAGAATTTTTTTTTTATTTAG

Sequences in the Contig:

SY0AAA25YP19RM1 SY0AAA36YP07FM1 SY0AAA44YH18FM1
SY0AAA52YH22FM1 SY0AAA53YE18FM1 SY0AAA58YK15FM1
SY0AAA7YB12FM1 SY0AAB12YA12FM1 SY0AAB23YE04FM1
SY0AAB28YO04FM1 SY0AAB39YE22FM1 SY0AAC31YL01FM1
SY0AAC62YF13FM1 SY0AAD10YB07FM1 SY0AAD15YP17FM1
SY0AAD36YN14FM1 SY0AAD38YL01FM1 SY0AAD4YN21FM1
SY0AAD61YH06FM1