Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1200
Length(NT) : 871
Best Gene Model Blast : Link to GSTUMT00007682001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_753397.1| Score: 160 E_value: 3e-09
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G12560 Score: 160 E_value: 1e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1200
GCACCGAAGGTCAGCTGTCTCCGTTCATTTGCCCTTCTGCGCCAAATTTT
CCGGGCGGAGAATCCCCTCCTTATGAATGGATTACACTCCGTCTCAATCT
CCTCCAGCAAGAGATTCCGAGTATGTCCTCCGGGCACCCGTGGGAGGGTA
CTATCCTTACGGCTCGCCCATAGTGCCCAATCTGCCACGCGCCCGGCTCC
GGCTCCACTGCAATCTCCATCAGCGGCCTCGAAGGGGTCCGGGGGGAACA
TCCCTGATAATTCCAGGGTGCTTTCAGCACTTGATACCAGCATCACGGGA
CTCACTCCAATCGCCATTTACCGGCGCGATCCACCCATTAGAAAACTCCT
ACAGGCGATAGAGAATAGGTCTGATCCGGCAATATGGCACCACTTCATGC
AGGCACATAATCAAGGTCTCACGTATCAATTGTCTGCCGGGGAGTTCTCT
TCAGTATTGCTTTCGATACGGCCGAGACGGTACCTGTCATTACGACCTCG
GCATTACATTGACGAGTACGGCCGTGGACAAGTTCACGAAGTGAATTATA
GTTTTAAAGAGTTCCGGTCGAGGTTGAGGATTGTCACCCAGGCGATGCAG
CAGCAGGGATACCAATTGGGCATTATCGAGTACTGCCACTTACTGGACTG
CGCGAGGGCCGGCGGTGACTTGAGTATGGCGGATGATCTATGGCGTCAGA
TTGTCGCCCGGGAAGACCTGACGCCGGATACGTGGACTTATAACTGCTAT
GTTGCCGCAAAGATCGGAACCATAGCTATCGGGCGGGGCGTCCGCATGTC
CCAATGGACGATGCAGAGTCGGCAGACTGTAACTGCTAAGCGCATGCGAG
CGCTCGCATCACAAATGTACG

Sequences in the Contig:

SY0AAA44YH10FM1 SY0AAC33YP22FM1