Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig120
Length(NT) : 1665
Best Gene Model Blast : Link to GSTUMT00002281001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein SNOG_08048
Accession: ref|XP_001798375.1| Score: 1582 E_value: 1e-174
KEGG Definition: predicted transporter (major facilitator superfamily)
Accession: aor:AO090005000962 Score: 1552 E_value: 1e-170
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 950 E_value: 1e-103
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 953 E_value: 1e-103
Swissprot: P49374|HGT1_KLULA

Sequence:
>Contig120
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTCCTTTATACCCTTTGGG
CTGAGAACACTCTCGATTCGAGAATAGGAGTTCGGGAGCTTCCTTGCGCA
AAATATTCACTATGGGGTACCGAGTGAGGAACATCTATGCCATTTGCTCT
TTCGCAGCCATTGGTGGTGGTCTTTTCGGTTTCGATATCAGTTCCATGGC
TGGTATACTTGGAACCAATGCCTATAAGAATTACTTCGGTAATCCCCTGG
GCGCTAGGCAAGGAGCTATCACCAGTGCGATGCCAGCTGGTTCGCTGCTT
GGTTCCCTCGTGTCTTCCTACCTCGGAGATTACTTCGGCCGTAAACAGGC
CATCCAAATCGGAGGCATTATCTGGATCCTAGGATCAACAATCCAAGCAG
CTGCCCAAAATGTGGGCATGTTGGTAGTCGGCCGTATTATCTCTGGAATT
TGTGTCGGTATAACTTCTACGATTGTCCCCGTCTACCAATCCGAGCTTGC
ACCCAAAGAAGTTCGTGGTCGAATGGTCTCCCTTCAACAATGGGCTATCA
CCTGGGGTATTTTGATCCAATATTTCGTTCAATATGGTGCTTCCTTCTAC
GGAGGTGGCCCCACCAATAAGCACCAAGGCCCAGCCGCATTCCGCATCCC
ATGGAGTATCCAGATTATCCCCGCTGCCATCCTCGTTGGAGGCATGTTCT
TCTTCCCCGAATCTCCACGTTGGTTAGCGGTTAAGGATCGGTGGGAGCAA
GCTCTTCGTGTCCTGGCCGATGTCCACGGAAACGGGGACCTGAACAACCC
AGTCGTTTTGGCAGAGTACCAGGAAATCGAGGACATTATCCGATTCGAAC
GTGAGGAGGCAATTTCATCATTTGCCGAACTTGCCAAGCCTAGGATTCTC
AGGCGAGTTGTTCTTGGTATGAGTATCCAGATGTGGTCTCAACTTTGCGG
CATGAACGTCATGATGTACTATATCGTCTACGTTATGGAGGGTGCTGGTA
TCGGGGACCCTCTTCTTACCGCTTCCATTCAATACATAATCAACGTTGTC
ATGACCGTTCCTGCTATCATCTGGATGGACAAGTGGGGTCGCCGTCCCAC
CCTCCTGTTCGGTTCTTTCGCCATGATGTCCTTGCTCTTGATCTCCGGTT
CTATCCAAGGAGTGTATGGTCATCCCGAAACAGATCCATCCTCTGCCATC
ACCTGGATCATGCAAAACAAGGGGAGTCAATCCAAGGCCGTCGTCGCTTG
CTCTTATCTTTTCGTCGCCACTTTCGCAATCACCTGGGGCCCCGTTTCCT
GGACTATGCCTGCTGAGGTCTTCCCCAACAAGGTGCGGGCCATGGCTGTG
TCCCTCTCCACCGCATCCAATTGGACCTGGAACTGTGTTTTGGCCTTCGC
CGTCCCACCACTACTCAGAACCATCAATTGGAAAATGTACATGATCTTCG
CTGCCTTCAACTGTGCAGCCTTCGTTCATATGTTTTTTACGGCACCTGAG
ACAAAGGGTGTTACATTGGAGGAGATGGACGACGTCTTCGATAGTGGCCG
CCCACCCTGGAAAACCCGGTCCCCGGTGTCCCGCCTCGACAACCTCCAGA
AGGACATTGCGGCAGGAAACGTCAAAGTCGACATCGGAGCCGCCACTGGG
CGCCGCACCGAGATT

Sequences in the Contig:

SY0AAA14YH06FM1 SY0AAA36YG04FM1 SY0AAA47YL13FM1
SY0AAA56YD09FM1 SY0AAB20YF15FM1 SY0AAB26YI23FM1
SY0AAB4YI20FM1 SY0AAB57YD04FM1 SY0AAB58YJ06FM1
SY0AAB9YF19FM1