Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig12
Length(NT) : 1251
Best Gene Model Blast : Link to GSTUMT00006165001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: MBOAT family protein
Accession: ref|XP_001270060.1| Score: 653 E_value: 3e-66
KEGG Definition: hypothetical protein
Accession: ani:AN6530.2 Score: 650 E_value: 3e-66
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2704 Score: 454 E_value: 9e-46
PFAM Definition: MBOAT, MBOAT family. The MBOAT (membrane bound O-acyl transferase) family of membrane proteins contains a variety of acyltransferase enzymes. A conserved histidine has been suggested to be the active site residue..
Pfam Number: pfam03062 Score: 198 E_value: 4e-16
Swissprot: Q08548|ALE1_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0005792 = Cellular component: microsome
GO:0003841 = Molecular function: 1-acylglycerol-3-phosphate O-acyltransferase activity
GO:0047184 = Molecular function: 1-acylglycerophosphocholine O-acyltransferase activity
GO:0046474 = Biological process: glycerophospholipid biosynthetic process

Sequence:
>Contig12
TTGGCTTAGGGCAGCACAAAGCGGAAGAGAAAAATCCCAAAGAGCCATCG
TCCGGCGATTTGGAAAGCTATTTGTGGGTTGGGCTGGATCGCTGCTTTTA
TGAAGTTTTCTAGCTGGTACAAGACCGGGTTTGTTCTCGACGACGGATTT
TTGCGGTATTCGGTTCTGAGAAGGGTTTGGTATATATACGCTTTGGGTTT
CACCGAACGTCTCAAATACTATGGCGTTTGGTCCCTGACTGAGGGCGCTT
GCATACTCTCCGGTTTGGGGTACAATGGCCTCGATGAGAACAAGAGGCCT
CGCTGGGACCGTTTGACAAATGTTGACCCTTGGGCACTCGAGACAGCGGA
GAATACAAGGGCTTACCTTGAGTCCTGGAATATGAACACGAACAAATGGT
TAAAGAACTATGTGTATCTGAGAGTGACACCAAGAGGAAAGAAACCGGGA
TTTAGAAGCTCTTTAGTTACCTTTGGGACATCAGGTACGAAGAGTTTCTA
AGAATTCATCCGAGAGGCCGAGCTAATCTATACGCAGCCATTTGGCATGG
CATCTCTCCTGGGTATTACCTCACCTTCTTGACGGCATCATTTGTCCAGA
CGGTCGCTAAATATTTCCGGCGTCACATTAGACCCTTCTTCGTGGAACCG
GACGGAAAGACACCCGGTAGGTATAAGAGGGCGTATGACATCTTCGGTCT
TTTAGCGACACAAATTGGGTTTTTCCTACATCGTCGCGCCATTTATCATC
CTGGACTTTAAGAACTCCCTCATAGTCTGGGGCCGACTTAAGTTCTTTGT
TCATATTGGCATCCTCCTCTCCATGCTATTCTTCAATTCGTCCGGAAAGT
CTTGGCTCAGTCAGAAGTTGAAGGCGAGGGTTGGAAGGGCTGCCAGTTCT
GAAGGTTTGCACAAATCGCCAAGTGCTAGCGATTTCCGTGGAGGCGCACT
CGGCCTTCTAGATCCTATGAAAGAGATTGAGGATATGCAACGAGAATTAT
TGGCGAAGGAGGAAGAGGTGATGAATAGGAGGAACTCAATGAACACCACG
AGCAAGAATAAATAACCCCTAGCTAATCTTCCCTTAGTAGAGAAGGTATC
ATAGCTAAAGCTGGAGGTGTATCCGAGGTGCAGCGTTGACCCCCCTCTTT
TTTTTTGCTCTCCCTACTGGGCGTTCATTCGCCTGCTAAATACTTTGTTG
TAAATAAAAGGAAGTTGGAGTTGGGTTGACACATTCTGCATTCGATGACG
G

Sequences in the Contig:

SY0AAA10YF02FM1 SY0AAA27YI06FM1 SY0AAC13YA21FM1
SY0AAC13YI12FM1