Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1199
Length(NT) : 1001
Best Gene Model Blast : Link to GSTUMT00010909001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_02486
Accession: ref|XP_001596266.1| Score: 418 E_value: 1e-44
KEGG Definition: predicted protein
Accession: aor:AO090026000662 Score: 417 E_value: 2e-44
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 108 E_value: 9e-06
PFAM Definition: No Hit Found
Swissprot: P39931|SS120_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig1199
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGTACCAACTCAATTATT
TGAGATCCTGCTTGCACAATACCCATACCATAGATATCCATAGACCAAAC
CCTCCCAGACACCCTTTCCATTCCATTCCAAACTTTTCACCAACTACTCA
CCCCCATCACAGCACCACCCTCACAATCACGGGACAATGCTCAAGTCAAC
GCTCCTCCTCCTCCTCCCCCTAATCCTCGCCCACTCTACCACCACCACCG
CCCACCAAAGCCAGACGGCGGACCCGCCAAAGTCATGGGCAGAACAGCAC
CTGGAGCAGGAACACCACATCAACAACTTCGACCCAGGCGCCTTCTTCAC
CCTCCACGACTTCGACTCCTCCGGCACCTGGACGCGCGCAGAGGTCCTGC
GCTTCTACGGCTTGAGTCAGCCGGACAGCACGTTCAGCGAGGATACGAGG
TCGCACGTCTGGCGCACCATCCTCGACTCCATGGACTTCAACCACGACGG
CGAGGTCTCCAGGGAGGAATTTCAGTCGTTTTGTGATGGTGGGAACACGT
TGCCAGATTTCGGGTTGGGACCTGGTCATCACGGTGATGATGAGTATGAG
TATGAGATTCATCACTTTGAACAATATCATAATGAGGATACTACTGAGGA
TGAGTTGACACATCCTGAGGATATTGAGCATGTATCATCTCCGTTCAGGT
CTTTGGATTGATTGATTGATTCTGAGCTGATTCGCGTTCTAGTTCCGGAA
GCACGATCAGGAGCGTGAGGCGGAGGAGAGACAGGTTGCTCTCGAGATGA
AGCCCATCGTTGAGCAGAACATTCCGAGAAAGTTTTTGGTGGACGGAGCC
TAGTATGGTAGGTGTGTTGGACGGGCATGATGGGGGCTGTGTGTATGTAT
AAAGGATGCATTTGAAAACGGGAGTCTGAGGTTATGTTTGCTTAGTTAGT
TGATCAGCTAGTTACCTCTAGCCTGGTGGTAATATATAATACCTATGCTG
T

Sequences in the Contig:

SY0AAA19YI03FM1 SY0AAA19YI03RM1 SY0AAA44YH05FM1
SY0AAB13YI21FM1 SY0AAB45YH07FM1 SY0AAB6YC22FM1