Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1198
Length(NT) : 1298
Best Gene Model Blast : Link to GSTUMT00011572001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: T-complex protein 1, theta subunit
Accession: ref|XP_001546510.1| Score: 1697 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ncr:NCU07567.1 Score: 1662 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0362 Score: 1446 E_value: 1e-161
PFAM Definition: Cpn60_TCP1, TCP-1/cpn60 chaperonin family. This family includes members from the HSP60 chaperone family and the TCP-1 (T-complex protein) family..
Pfam Number: pfam00118 Score: 967 E_value: 1e-105
Swissprot: P78921|TCPQ_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0007021 = Biological process: tubulin folding

Sequence:
>Contig1198
TTGGAGGTCACTCTCGATACTTTTCTTCAACCTGCTATCTTCTATCAACG
ATGTCGTTACAAATTCCGTCCGCCCCTGGCAGTGGGCTCTTTAAACAAGG
CTATCAATCGTATGCAAGTGAGGATGGAGCCGTCATCAGGAACATCGACG
CCTGCCAGACAATCGCTTCGACTGTACAAACTTCTCTCGGGCCCTATGGC
CGGAATAAGATTGTCATCAATCATCTGCAGAAAATGATCCTTACGTCTGA
TGCTGCAACGATTCTGCGGGAGTTGGAGGTTGTGCACCCTGCAGCTAAGC
TAGTCGTTATGGCAAGCCAACAGCAGGAGGCGGAGATGGGTGATGCTACA
AATTTGGTTATTGTTCTTGCTGGGGAGTTCATGAAGATGGCAGAAGGATT
GATCAGAATTGGATTGCATCCGTCGGAGATTGTTAATGGATATGAGAAGG
CCCAAGAGTTTGCTTTGAAGACTTTAGAGGAACTTGTGGTTGATAGGATT
GCGGATATCAAATCGGAGACCGGGCTCACAAAAGCTATTAGAACTGTTAT
CGCGTCAAAACAATACGGGAATGAGGATCTACTCGCCCCCCTGGTTGCTC
AAGCTGTTCTTGCCGTTCTACCTAAAAACCCCATCAATTTCAATGTCGAT
AACATCCGAGTGGTCAAGATTATGGGTTCGTCACTCCCCCAGAGCCGTGT
CGTGAAAGGAATGGTTTTCCCTCGGGAGCCAGAAGGTACAATCAAGAAGG
CTCTAAAAGCTAAGGTTGCTGTATTTTCCTGCCCTATCGATATTTCCCAG
ACGGAGACCAAGGGGACTGTTCTAATCCACAATGCAAAAGAAATGTTGGA
TTTCACTAAGGGAGAGGAATCGCAATTGGAGACCATAATTAAGGAAATTC
ACGATTCAGGAATCAGGGTGGTGGTTGCTGGATCAACAGTTGGAGAATTA
GCTATGCATTACCTCAGCCGGTATAGCGTTTTGGTCATCAAGATTCTTAG
TAAGTTTGAGCTTAGACGGCTGTGTCGAGTTGTAGGCGCTACTCCGCTGG
CTCGGCTGGGTGCCCCCATGCCAGATGAGATGGGAGCGGCCGATGTTGTA
GAGACTGAAGAGATTGGTGGCGATCGAGTAACAGTTTTCCGGCAGGAAAA
TGAGGCAACCAGGACCGCTACAATTGTTATCCGAGGTGCTACCCAGAATC
ACCTTGATGATGTCGAGAGAGCTGTGGATGATGGTGTCAATGCTGTGAAG
GCCATCTCCCGAGATCCCCGTCTGGTCCCCGGCGCAGGAGCTACAGAG

Sequences in the Contig:

SY0AAA40YG10FM1 SY0AAA44YH04FM1 SY0AAC53YM15FM1
SY0AAD52YG23FM1