Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1197
Length(NT) : 773
Best Gene Model Blast : Link to GSTUMT00006417001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: acyl-CoA synthetase
Accession: ref|XP_001545851.1| Score: 635 E_value: 2e-64
KEGG Definition: hypothetical protein [EC:6.2.1.3]; K01897 long-chain fatty-acid-CoA ligase
Accession: mgr:MGG_01551 Score: 606 E_value: 2e-61
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1180 Score: 472 E_value: 4e-48
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 146 E_value: 2e-10
Swissprot: O60135|LCF1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0004467 = Molecular function: long-chain-fatty-acid-CoA ligase activity
GO:0001676 = Biological process: long-chain fatty acid metabolic process

Sequence:
>Contig1197
TTGGCCTCTTCATCCATCCATCCATCCGTTTTACTCATTCGTCACCCTCC
CTCCGTCCAGTAGCCCTTCATCATGGTTGTTCAAAAGAAGCCTATCCCAA
CTCCCGCCATTCACAAAAAGGGACCCTTTAATGTTCAGGTCCCCGGTGTC
GAGAAGAAGGAAGGCGAGGGAATCCCCCGTCGTCACCCTAGTGCCGTTGC
CGAACTGGTATCGCGCCTGGAACCCGACATTGCGACTACCTACGACATTG
TCAAGCGTGGTGCAGCAAAATTCGGTGATGCCCAGGCTCTTGGATCCCGC
AGCCTTATTCAGGTTCACGAGGAGACAAAGATGATCAAGAGGATGGTTGA
TGGTGTTGAGCAGGAGGTTCCGAAGAAATGGGCATACTATGAAATGAGCG
GATACACGTACATGTCGTTCAATGAATATCTTGCTCGTGTTAACACGACC
GGAGCTGCGTTGAAGGCGTTGGGATTGAAGAAGGGCGAGAAACTGCAAAT
TTTCGCTGCCACTAGTGCAAACTGGCTTTTGGTGTCGCATGCCTGTGCAT
CACAATCGCTGCCAATTGTCACTGCTTATGACACTCTCGGCCAATCCGGC
CTCACCCATTCGCTTGTGCAGACCGAGGCAGCCGCCATTTTCCTCGACCC
CCACCTTCTCCCACAACTTATTAACCCTTTAAAGGAAGCGGTTAATGTTA
GATATGTCATCTACAACACTGATACCCCGGTCAAGCAGGAGGATATCGAT
ACCTTGAAGGCTGCGCATGAGCG

Sequences in the Contig:

SY0AAA44YG19FM1 SY0AAC30YM21FM1