Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1196
Length(NT) : 1131
Best Gene Model Blast : Link to GSTUMT00007470001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CIMG_01934
Accession: ref|XP_001248163.1| Score: 957 E_value: 1e-101
KEGG Definition: FGF receptor activating protein 1
Accession: aor:AO090005001276 Score: 933 E_value: 5e-99
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3979 Score: 172 E_value: 3e-13
PFAM Definition: No Hit Found
Swissprot: Q9HDZ2|YKPC_SCHPO
Gene Ontology:
GO:0032153 = Cellular component: cell division site
GO:0051286 = Cellular component: cell tip
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0046476 = Biological process: glycosylceramide biosynthetic process

Sequence:
>Contig1196
TTGGACTTCCTCATTGCTCTGCCGTTTTCTGTCATTCCTTGATTCTGCTT
TTGCTTGCGCTCTAGTCATGCCAAAAGATAAGGATGGGACCGTTTTGGTC
TCGATGTCCGGGAAGTGGGTTTCCCACACTCACACAGTAACTGCCTATTG
CGGATTCCTAGGCGCGTTGATCGTGGGAATGTCACTCCACTTTCACAAAA
TTGTTCAGAATGAGCATTATGTGAGTTTTCGCTTTAGCTATACCTGTCAT
TGCTGCCGTACTCGTACCTCAACTTCTCGGCTCGGACCTCCCTTGTGGCT
TTGCTATGATAGTTGCCGAACAATAAGGGTTGGCGTGGCTGACCCTTACC
TTCCAACGAAAAGGGTTATCCCGACGAATGGTTTCCATCAGTGTCAGCTA
CAATTGGCGACAGATATCCTGAACGATCGCTGTTTCAGCTCTTCATCTGC
TTAACATCTGGTCCTCGTTTCGCCCTCGTTTTCCTGTGGTACCTTCTTAC
GGCACGCCCCGGCGCTTTCGCTCCAAAGTTTGTGGCCAGCATTGGTCTTA
TCCGTTCGTTACTTTGTGGAGGCTGGGTATACATTACCTCCACCGATGAC
CATGACTATCACGATATCTTTATGATTTCTTACCTCGTCTTCACCCTCCC
TTGGACGCTCGGTTGTCTCGCCCTGTCCCCCATGAACCTTACAGCAATCA
AGTATAGAAAGTTATTTGCTGGTCTTTTCTTTGGTACCCTTGTACCACTG
ATTTATTTCTTTATCCAGCACAAGGTCCACAAGGTCGCTGGAGCTTACAC
TATTTACGCTTTCTTTGAATGGTCTCTCATCTTATTCGATGTTGGTTTTG
ATGCTGTTACTGCCCTAGATTTTGAAGGATTCGAATTTAGAGTTGTAGAT
GTCAAGAGTGTCAGCAAAGGAAAAAATATAGCGCTTTCCGACGCAGTTCT
CGAAAGATCAAAGATGGATAAAAAGGATATCCCACAACAGTTTTTAACTG
ACACTTACTCATGGAACGATGTGCTCGATGCTCTTGCCGATGTTTACAGC
GGGTTCATGTTTTGGTCCATCCTGACATCACTCGGAGTGACTATTTGGTG
TAAGTCACGAGCAAATCGAAACAGCTTTGAG

Sequences in the Contig:

SY0AAA10YA21FM1 SY0AAA17YA04FM1 SY0AAA44YG11FM1
SY0AAB5YH19FM1