Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1195
Length(NT) : 739
Best Gene Model Blast : Link to GSTUMT00003349001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: mitochondrial import receptor subunit tom-22
Accession: ref|XP_001560841.1| Score: 246 E_value: 2e-19
KEGG Definition: predicted protein
Accession: aor:AO090001000378 Score: 219 E_value: 1e-16
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG4111 Score: 199 E_value: 1e-16
PFAM Definition: Tom22, Mitochondrial import receptor subunit Tom22. The mitochondrial protein translocase family, which is responsible for movement of nuclear encoded preproteins into mitochondria, is very complex with at least 19 components. These proteins include several chaperone proteins, four proteins of the outer membrane translocase (Tom) import receptor, five proteins of the Tom channel complex, five proteins of the inner membrane translocase (Tim) and three "motor" proteins. This family represents the Tom22 proteins..
Pfam Number: pfam04281 Score: 341 E_value: 5e-33
Swissprot: Q07335|TOM22_NEUCR

Sequence:
>Contig1195
TTGGCAACCACCAACCACCTCAACCTCATCCTCCGCGAAAAACAACCCCA
ATTCCTATCCGATAACAACAACAGCAACAATCTGCGAAAATGGTCGAACT
CCGTGAAGTAGAGGATGAGCACTTCGTCCACTCCCAACCTGCCCATTCCG
ACGACGAGGACTACACCGACACCGATAGCGAGATCTCAGAGGAGGACGAG
GACGATGACGTCGACCTCGAGGAGTCCTTTTACGAACGGATCGCAGCGCT
CAAGGACATGATACCATTGAAGCAGAGGACCTACATTTCCAATGGCTTCT
CAAGGACTTACAACTTCTTCAGCAAGGGATTTGCGCTCGGTGGGAAGACG
CTCTGGATTCTTTCCACCAGTGCGCTGGTGCTTGGAGTGCCCTTTTCTGT
GGCGATTACGGATGAGCAACAGGTTGCCGAGATGGAGAAGGAGATGAAGA
TGACCCAGATAGCTACTGATGCACTCACCCCCGGCGCGGAATCGGTACTC
ACCACCCCGCAAAAGTAATCTCAGAAACTCTCCTGTACAGAAAACACTTG
CAATGTATATTATTTTTGGGGGGGTTCTATTTTTTTCGTGTCTCTCTTGG
GGATTAGATGGATGCTGGTCTGGTGGGGGGAAAGGTGGTGTGGTATTCTC
TCCTCTGTTACGTGCGGTTTTGGCTATTCAATGATGGGTTATGAGGTGAT
GATGTGTTGAAGCTATCAATGACCCCTTCCAGCGGTCCG

Sequences in the Contig:

SY0AAA24YC22FM1 SY0AAA24YC22FM2 SY0AAA44YG01FM1
SY0AAA48YL18FM1 SY0AAA54YH12FM1 SY0AAA60YC02FM1
SY0AAA61YC24FM1 SY0AAB23YB09FM1 SY0AAB3YI05FM1
SY0AAB53YM02FM1 SY0AAC42YH15FM1 SY0AAC48YE07FM1
SY0AAC54YH22FM1 SY0AAD13YF02FM1 SY0AAD18YC20FM1
SY0AAD33YN01FM1