Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1194
Length(NT) : 954
Best Gene Model Blast : Link to GSTUMT00005613001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1194
TTGGGGGGGCAATCGGGGTACAGCACCTCGGAGCCTACAACTTCTGAAAA
TCCGGGGACCCTAGAGGAAGATCTTCTAGCGGATTGGCTGAGGGCTCGGG
AGTGCCCTGGGTATGAATACTCGGGTGACCTGCACGAACTTGAATTCAAG
AAACTGGCTGATGCCAAGAGACGAGAGTGGTTGCGGTGTCTGAGTCTTGA
ACGTGGGAGGCCTACGAGCATAGAGGAGCGTCGGGGGTGGAAAATATCTC
CTGAATTCTTGAAATTGCGCAATGGGTTCTATGCGGTTGTAGAGAAGGTA
TTCAATTTGCAACTCGGTAATTTCTGCAGAGTTACCGGATTAACGCCCTG
GCAAGTATTTGTCGAGCTATACGGCAACGGACAGCAAAATGTGGGAAAGC
GAGACGCAAAAACGATTCTTCACAGGGTCTTCATCAATATATTCGATTTT
CTGGATGCCTTCGGGGAGACTCTCAAAAACCCACGCACAACTAACGGGAA
AAAGGCTTTGCGCAAACTTAAGCCGCTCGCCAGGGAGTTGCAATTTCCGA
GCAACCTGATGCTAGGAGTGTACAGCGCTCTGACGAATCGCGTATTCCCC
ATCGACGTGGTCGATAGACAAGGGACGCTCGTTTTATTACTTCAACCTAT
AAAGGTTTATTTGCGAAGTTTTGATGATGTTATGCGCGAGTTTGAGGAAG
AGGCTGTAGATGAACTGCAAGAAGCGGAGGAAGAAGGGCGGGTTGGAATA
AGGAGGTTGCTCCTATCAAGAGAATGGGATTCCTTGGATTCTCTATAATC
CGAGCTGTCATCTGCTCTTCTAAAACTTCGAGGTTGTATGATTCCAGGAG
TGTGCGCTGCTGTTGATGAGGGAGGTGCTCGGGGCAAGGGTGCCGTGGTG
GAAAGTTGTGGGGATGGTTATGTGTTTCTCTCGTTATCTGGGGCTGTGGA
GGAC

Sequences in the Contig:

SY0AAA43YC24FM1 SY0AAA44YF23FM1 SY0AAB21YN18FM1
SY0AAB42YL12FM1