Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1192
Length(NT) : 1007
Best Gene Model Blast : Link to GSTUMT00006536001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: alpha-mannosidase
Accession: ref|XP_001263620.1| Score: 962 E_value: 1e-102
KEGG Definition: alpha-mannosidase [EC:3.2.1.24]; K01191 alpha-mannosidase
Accession: aor:AO090005001458 Score: 951 E_value: 1e-101
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4342 Score: 706 E_value: 4e-75
PFAM Definition: Alpha-mann_mid, Alpha mannosidase, middle domain. Members of this family adopt a structure consisting of three alpha helices, in an immunoglobulin/albumin-binding domain-like fold. They are predominantly found in the enzyme alpha-mannosidase..
Pfam Number: pfam09261 Score: 271 E_value: 1e-24
Swissprot: P22855|MAN1_YEAST
Gene Ontology:
GO:0005774 = Cellular component: vacuolar membrane
GO:0005515 = Molecular function: protein binding
GO:0009313 = Biological process: oligosaccharide catabolic process

Sequence:
>Contig1192
GAGCACATTGAGAAGCTTCGTCGCTGCCGCGGCATGAGCGACACTATTGG
TCTCCTTCCTCGTGTTAAGATGGGTGATAGTGTCGACGATTTCTTCTCCC
GGTTAGAGAAGAAGCAGGGGTCTGCAAAGAAGTTCGTGACTTGGTACGGA
GAGCTGTACTTTGAACTTCACAGAGGAACGTACACTACCCAAAGCAACAA
CAAGAAGAACAATCGCCGAGCCGAAGTGGCATTGAAGAACGTTGAACTAT
TGTCTGCATATGCCAGCTTGAGCAGTATCTATGGATACAAGTACCCGAAG
AAGGACATAGATGAGTTATGGGAAATCATATGCTTATGCCAATTTCACGA
CTGCCTTCCCGGGTCATCTATCGAGATGTGCTATCGGGATTCTGATAAAC
TTTATGCTGAGCTTTTCCGGAGGTGTGGGGAACTCATCGAGGAATCCGGT
CTGGCTCTTGGTATTAAGTCTGCTCCGGGCTCTGACACTAAGCCTTTTGC
TGTGAATACCCTCCCTTGGGACCGCACGGAGCTGGTTAAGCTTCCGAAAG
AGGTGGCTGGAGCTTGTCAGAAGGGGGCAGACGGCAGCGAATACGGCTTC
TTGGGGACTGAAGGACTTGTTCAAGTTTCTGACGACGGTCCGAAGGTTAC
CGTTACCGAAACTGCAAAAGATGTTTACGTTCTTGCGAACGATAAACTGC
AGGTTACGGTTGAGAATGGAGTAATCACCAGTCTGATTGACCGCGAGTTG
GAACGTGAGGTCATTCCGGAGGGTGCTAGGGCTAACCAGTTGGTTATTAT
GGATGACAAGCCCTTGTACTGGCAAGCATGGGACGTCGAGGTCTATCACC
TAGAGACTCGTCGGGAGTTGCCCACGGGCAAAGTTTCCGTTTATGAGAAT
GGGCCATACAGGGCCAGTGTCCTTGTCGAGACCCAGATTAGCGAGACCAG
TTGGATCAAGACCATCATTAGTCTTCAAGCTGCAGTGAATGGCGCGGGTA
GCCTTGT

Sequences in the Contig:

SY0AAA44YF11FM1 SY0AAC35YH19FM1 SY0AAC54YD24FM1