Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1191
Length(NT) : 513
Best Gene Model Blast : Link to GSTUMT00006169001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: NADH-ubiquinone oxidoreductase B14 subunit, putative
Accession: ref|XP_001257667.1| Score: 437 E_value: 6e-42
KEGG Definition: hypothetical protein
Accession: ang:An15g00690 Score: 430 E_value: 2e-41
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG3426 Score: 221 E_value: 3e-19
PFAM Definition: Complex1_LYR, Complex 1 protein (LYR family). Proteins in this family have been identified as a component of the higher eukaryotic NADH complex. In Saccharomyces cerevisiae, the Isd11 protein has been shown to play a role in Fe/S cluster biogenesis in mitochondria. We have named this family LYR after a highly conserved tripeptide motif close to the N-terminus of these proteins..
Pfam Number: pfam05347 Score: 135 E_value: 2e-09
Swissprot: P42114|NDUA6_NEUCR

Sequence:
>Contig1191
TTGGGCTATCCCCTCCACTCAAGATGGTTATCAACCCCACCAATCTCGCA
AAGACTACCCGCGTCTCGACCGGCTGGCCGGATGCCCGCTCTCGAGTAAT
AAAATCTTATCGGAGCTGGCAGCGAGCTGCCCCAGAGATCGTAAAGCAGT
ACCTGCTCCACCTTCCGGCCTCGGCTATCCGTGCGAAGATTCGACAGGAG
TTTGAGCGGCATCGCTATGTGCAGCAGTTGCCGGTGGTGGATGTGCTCAT
CACGAAGAGCAACATGGAATTGCAGGAGACGATGAATTACTGGAAGCAGA
TCCCGCACATTATGAAGTACTTCAGGACAGAAGAAGACCCAAGGACCAGG
TTATCTTCGAACTTTATGAATAACTTCTTGGAGGGGCGCAATTAACCACA
CACCTTTTATATGGCCAATGCCGGGCGGGTATTGTGGGTGCTTTGATTTG
CTTCCCCGCTTCGTCCGCTAATGTATATCTTTTACAATAGAAATATAACA
TGAAGATACATAT

Sequences in the Contig:

SY0AAA44YF01FM1 SY0AAB16YG21FM1