Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1190
Length(NT) : 2268
Best Gene Model Blast : Link to GSTUMT00005680001 E-value : 0.0
Numbers of ESTs : 21

Blast Results:

Nr Definition: pH-response transcription factor pacC/RIM101 emb|CAA67063.1| PacC
Accession: sp|Q00203|PACC_ASPNG Score: 562 E_value: 2e-55
KEGG Definition: pacC; transcription factor pacC-Aspergillus niger
Accession: ang:An02g07890 Score: 559 E_value: 3e-55
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 121 E_value: 7e-07
PFAM Definition: No Hit Found
Swissprot: Q00203|PACC_ASPNG

Sequence:
>Contig1190
TTGGGGCACTTGCAGAACTACTACCGTCAAGCGGGATCACATCACCTCGC
ACATCCGCGTCCACGTTCCGCTTAAGCCGCATAAGTGTGAATTCTGTCAG
AAAGCTTTTAAAAGACCTCAGGATCTAAAGAAGCATGTGAAGACACATGC
GGACGATTCTGTCCTGCTCCGTTCTCCTGAGCCGGATGGGTTAGGTAGGA
GGGCATCCGCCGTTCACCAAGCTCGGGGAGATAATGTTCATGGTCAGTAT
ACCACCGGTGCGGGAATGCAACCTCTAGCTGCGACTGCTGCGCAGGCGTA
TTACGGTATCGGCGCATATTACCCCGGCCCCAACCAAGCGCCCGGAGCCG
CTCCAGTATATTACTACAACGCTCCCCAGGCTCCCCAGCAAGACATGGCC
CAAGCGGCGCCTCTCAGCGAGAATAATAAGAAGCGCAATTATGATGGGAT
GGATCAGTTCTTCGATGACGCTAAGCGACACAAGATCCAACCGGTTTACG
ATGGAGCCATGGCGCAGAGGCTCTCTGCATTGCAATTCGTTCCGACCACT
AGTGAGGGTGTTGATTTCAACGGGCATCATGCGCCCACCGTGACTGCGTC
CCCATCGGCCCAGACTCAATTCACCCTCCCGTCGCTCCGGACGAAGCAGG
ACCTAATTGACGCTGACAACTTCCTCACCCAATTGTCTGCTAATGTTTAT
GAGAACCCTGCCGCGGCTACCGCAGCTGGCGTTCCGGCCGGTGGAGCGCA
TTTTACTCAACAGTATCGCCCTAACCAACCATCTTCCCCGCACGGCACTC
CTGCTGCCCAACCGCAACAGCATAGTCCTAGCCATACTCCTGTTGCGCAC
GATACTACCTCGACCACTGCACCGACTATACCCGCTACCTCTAACTCGAC
TGGTACTCCCGCTTTGACCCCACCCAGTCAACAACACTCAACACCTCCTA
CCGTCTCGCCTCAGACTTCGGCCTCGATGTACCCAACTCTCCCGGCTGCG
GTTACCAGCAGTGAGATGTCTGCTGGATATCCCGCACCAGTTTCCACTGC
GCCCCCCACTTCCCTCGGGCCAACTTTCGAGTCTGAACAGCGCAGGAGGA
TTAGCGTCGGTGTATTACAGAAAGCTTCGAGATCCTCAGAGGATACCGAC
GTCGATATGGGAACCGATGATATCTTTGGCAACTTAAAGAAGAACGAGAT
CAGCAGTAGCCTCATCGATCCCGAGCTTGGCGCGTTGTCTGGAGAGACAA
TGCAGCAGCAGCAGCAGCAGGAAGAGGGTCCCCCGGCAGCAGCCGAGAAG
GACGAGATCGTCTCCTGGGAAAGGAACATTGGTGTCATCAATAGTCTTCG
CGATTACGTTAAAGAGCTATTGAGGGAGGAAGATGAGAAGGAAAAACGTG
GTGAGGGGGAGGATCACATCATGACGGACCACGATGGCGGTGTCGACGCA
TCAAACGTAGACCAGCAGCCACAGGAGGAGGGCGGAAGTGATGAGCGTGC
CAAAGAGGAACAAACGGATGCTCAGGCCCTCTACCCGGTTCTGAGGGCTG
TCGCCGTAGCTTGATAACTTTTTCATGATTTATCCCTTCTTTATCGGACG
ATCCATAGCGGGGTCATGAAGTTATGATGGTTGTACCAGCAAGAGTGGAG
GGGTTAGGTAGAGGAGGAGGTGAAGGGTACTATTCAGGCTTCGATTTTCG
TTTCATCTCTTTTGCTTTTCTCCTCCTGTCTTCAACCTCCCTCCTTTTCT
CATTTACTACTACGATGGCTGGAGCTTTCTCTTCTTCTCCTTTCCTTTGT
TCAGTTCTGTTGCATTTCCTTCAACCTTCCCCACCCCATCCTTCTATCCG
TCTCGCCTCTGGATGAATGGGTTGGAAGTTCCGCGCAGGCCGGCCGTCTG
TCCCATCGTGAGGAAATAAAGGGCGGAGGGAATAGGGAGGATTTTCAGTA
AACTACTTACACTCTTCGTCGTGAATGTCTGTTCTTCCTTGTTTGCTTGC
TCACCTGTTCTTTCTGTTTCTTAGACAGAAAACTACGAAAAAAATACTAT
TTCTCCCCCCCCTCCTCTTTATATTACAAAATGGAATATTTTCTTGCCCC
CTTTGCTCTCTCTACTCTTGTGTTCTCAACCCCTTGACACTGGGGTTTTT
CTTCTTTGCCTGTTTTGCGTTTTAGTTATTTTATTTGTTACGGGTTATTT
CTTTCATGTAATTCTTTTCTTCTTTTCTTTATTAGTCGTGTGTTGGTAAA
ACAAATGGTTGTCTACTC

Sequences in the Contig:

SY0AAA31YO05FM1 SY0AAA39YG05FM1 SY0AAA39YN21FM1
SY0AAA3YG10FM1 SY0AAA44YE20FM1 SY0AAA55YB20FM1
SY0AAA62YE12FM1 SY0AAB12YO15FM1 SY0AAB20YH02FM1
SY0AAB57YC02FM1 SY0AAC22YD18RM1 SY0AAC39YH01FM1
SY0AAC48YK06FM1 SY0AAC59YK21FM1 SY0AAD14YE24FM1
SY0AAD21YF23FM1 SY0AAD31YO04FM1 SY0AAD35YD24FM1
SY0AAD45YG21FM1 SY0AAD50YC14FM1 SY0AAD63YJ03FM1