Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig119
Length(NT) : 1474
Best Gene Model Blast : Link to GSTUMT00005771001 E-value : 0.0
Numbers of ESTs : 67

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig119
TTGGGGAAGGTAATTCATAAGGGCTCAGTGCGCCCACTGGGGGTCGATTG
GAAACGAGTTGGTCTGACTGTGGTTGGATTGGATACCTGCTGTGCCGGTA
GAAAAAAGGAAGGGAAAGAGAAAAGAGTTCTGCCTATCATTACCATGGCT
GGTTCTACTATTGCTAGTTTCCTAACGGCCCCGACAATCCGGCTCATTCT
CCCCACCGGCGACTCCGGGGAGGAGGACCTTACGTACTCCGTCCACCGCC
CGCTCCTGGCAAAGTATACTTCGCTCTTACAATCGCGTAAGCCCCGCGAC
TCGTATGTCCTCCTCGACCCGTCGAGCGTGAGCGTTCCCACACTCGATCA
TGCGCTAGAATTTTTGTACACGGGGGATTACGTGCTCCCCGGTGAGCCGG
GAGAGGAGGAAGAAGCTGATGACCAACCGTTGCTGCATTCCACTCGGCCA
GCGGCGCATCTCCCCCGCTCCCCGCTCATGTACGCCGCTATGGCGGGTGC
TATAGGCGTGTGGGGTAAGCCCGCGCCGGTGTTTGAAAAAGCGGACAACA
CATCGACCTACACGTCGGAGTACTTTCCCGAGCAGAAAAACGGGGAGAAG
AAGACCGCCAAGGTGAATGGCAATGACCACAGCGCCCAGGGTGGTAGTAG
TAGCAAGCTCAAGTTTCCGAATGGGTTGTTACCTTCTCCACCGCCGACGC
CTTCGGCGTCTACTTTCCCATCCTACTCCCCAGTGCTCTCGCCAAAGACC
TCCCGCTCATCGAGCCTCTCCTCCCAACCCCCCCCGAAAACCCCCGCCGT
GCCCCAGGAACCCCACCACATCCACATCCTCCACACGAACCTCTTGGTCT
ACCGCTTCGCCAGCCTCCCAACCGTGCAAATGCCCGCCCTTTCAGCTCTC
GCACTGCACAAGCTCCGCACTCAATTCGCTCAGACGCCGCTGGAAACGCT
CCCATCCCTCGTCATCGAGTTCGCCCGGGAAGTATTCATCGCACGTAGCG
ACGAAATGGAATTGAGAGAGGCCCTGGTGGAACTGGTTGCTGGCCGGGCG
CGCAAGCTCAGCTCCAAGGGGGAATTTAGCGAGTTTGTTAAAGGGGGCGG
TGAGTTTGTCGTATTGCTCTTCGCCAGGTTGGCGTTGTGCGAGTGTTGAT
TGTTGATTCGGAATGGCGGGGGTGCTGCGGGTGAGTGAGTAGGCGTTGGG
AGTTTGGTCGGTGTTTGGAGAATGAGAGATGGTATCTTTGACGAGGCCGA
CGAGAAGATTTTGAGAAGGATTTGGGGGTGTTAGCGGTTTTGTAGGATAG
GTTTGGGTTTGATGGGTGGGTGGATGGATGGATGAGATGTTGGTTTACTT
GGCTCTTTTTTTCTTTCTCTCCTTTGGCTCGTTTTGGACTGGGTTGTCGT
ATTAGTAGTGGCGGCGGGCGGACCGGGCGCATGTTCAAGATATCCCTTGT
GATTTCGTAATTTTTGGTTTTGAG

Sequences in the Contig:

SY0AAA14YG22FM1 SY0AAA16YC11FM1 SY0AAA1YH04FM1
SY0AAA20YM17FM1 SY0AAA21YL14FM1 SY0AAA22YL16FM1
SY0AAA26YL07FM1 SY0AAA27YI16FM1 SY0AAA28YC22FM1
SY0AAA28YG12FM1 SY0AAA2YL13FM1 SY0AAA30YF03FM1
SY0AAA36YM03FM1 SY0AAA40YM16FM1 SY0AAA40YM18FM1
SY0AAA47YK11FM1 SY0AAA50YJ04FM1 SY0AAA53YL08FM1
SY0AAA53YM22FM1 SY0AAA57YM12FM1 SY0AAA7YD06FM1
SY0AAB12YP21FM1 SY0AAB13YD22FM1 SY0AAB13YP21FM1
SY0AAB14YC05FM1 SY0AAB15YE16FM1 SY0AAB17YD07FM1
SY0AAB17YE13FM1 SY0AAB24YL01FM1 SY0AAB26YD08FM1
SY0AAB26YE02FM1 SY0AAB2YC03FM1 SY0AAB30YN03FM1
SY0AAB30YO16FM1 SY0AAB32YG07FM1 SY0AAB39YK05FM1
SY0AAB42YH21FM1 SY0AAB43YP03FM1 SY0AAB45YP15FM1
SY0AAB4YH23FM1 SY0AAB50YK24FM1 SY0AAB51YJ23FM1
SY0AAB51YM15FM1 SY0AAB52YG13FM1 SY0AAB52YH03FM1
SY0AAB52YP10FM1 SY0AAB55YA14FM1 SY0AAB58YK17FM1
SY0AAB7YP01FM1 SY0AAC12YH12FM1 SY0AAC24YF15FM1
SY0AAC34YJ19FM1 SY0AAC35YJ19FM1 SY0AAC36YN02FM1
SY0AAC40YK24FM1 SY0AAC41YA23FM1 SY0AAC46YB04FM1
SY0AAC48YM23FM1 SY0AAC52YL16FM1 SY0AAC56YL22FM1
SY0AAD10YC23FM1 SY0AAD16YD14FM1 SY0AAD23YJ12FM1
SY0AAD30YI04FM1 SY0AAD38YF13FM1 SY0AAD40YF10FM1
SY0AAD57YF18FM1