Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1189
Length(NT) : 710
Best Gene Model Blast : Link to GSTUMT00005322001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein MGG_04559
Accession: ref|XP_362114.1| Score: 296 E_value: 1e-36
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04559 Score: 296 E_value: 5e-37
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3745 Score: 172 E_value: 2e-13
PFAM Definition: Sec10, Exocyst complex component Sec10. This family contains the Sec10 component (approximately 650 residues long) of the eukaryotic exocyst complex, which specifically affects the synthesis and delivery of secretory and basolateral plasma membrane proteins..
Pfam Number: pfam07393 Score: 166 E_value: 1e-12
Swissprot: Q06245|SEC10_YEAST
Gene Ontology:
GO:0000145 = Cellular component: exocyst
GO:0005515 = Molecular function: protein binding
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0006893 = Biological process: Golgi to plasma membrane transport
GO:0006904 = Biological process: vesicle docking during exocytosis
GO:0006906 = Biological process: vesicle fusion

Sequence:
>Contig1189
TTGGTCAACATCGTAAACAATGACCAAATCTACTGTTGCTGAGTCTTCAC
GCACCTCCCGCTCAATATACCCTAAACCAAGCTCATTCTCCTTATCTCAC
TTCTCCACCGCTGATTTCATCGTGAAGGACTTCATAGAAGGCCTTACCGG
CTCCGCAATTCCCGCGAATCGTCGGTCGGGAACAAATTTTGGCAGTATCA
TCGCTCTCCCTTAGCTCCCAGTCTAGCGCTCTGATGGCTAAAACATCGCT
CAGCACCAACCTTCGATCCCAAACCCTACATCCGCACATTTGAAGGCGCT
CTGGAGCGGCTGAAAGACCTTGATGAGGACCTCTCAGCAAAAGAGTCTGA
GCTTAAAGAAGGCGTACGAAGGGCAGAGATGGACCATGCCCGCACAATTG
ATCGCTTAAGTCTCCAATTTAACACCACCTTGTCGGAGTTTCAACGCCTC
GATAGCAGCATCACCGATGGCGGGGGCATGGCCTCTAGGATAGGTGGGCA
ACTGGAGCAGCTGGAGAAGCAGCATCAGCGGGCTGAAGATGCAAAGTTCT
TAATACAGTGCTACACAGAGTTTAGCCGTGGAGATACTTCCCGATTAGAA
AAGCTGCGGCGAACTCCCTGGGTTGAGGATAGCATCAAGTGTGCCATTGT
CAGTCGACAGTTGAGCTTGATTGCCAAACGAAACGAGGGAACCGCCAAGC
CGGGGACAAA

Sequences in the Contig:

SY0AAA33YO11FM1 SY0AAA44YE13FM1 SY0AAC26YG18FM1
SY0AAC30YB18FM1 SY0AAC39YP11FM1 SY0AAC41YB05FM1