Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1188
Length(NT) : 1032
Best Gene Model Blast : Link to GSTUMT00010569001 E-value : 2e-93
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 190 E_value: 1e-12
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 128 E_value: 9e-06
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 110 E_value: 6e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1188
TTGGGGCAGTACACCGTATCTTCCATACATTCTAACTTCATAATGGCTGA
TATTTGTATGTCTTATCTTTCGCTAGAAGATTTTGGGAAGGACCCATTAC
CAGAGGATGCTGGCGGCGTTTTTTTCTCGCAGAAGCAAATTGATTACAAT
CGGCAGCTGGAGCTATTCGAACTTACGCGCCGGATTTGCGAATTTAGGTC
AGATAGGTTTCTAATATGGTTTAAGCTGTTCTGGAGGAATAACCGGGGGT
CGAGGCACTCTTATGATCCATTCCCCAAAGATTTTACAAGTTTAATGATA
GCATCATGGCTTGGGCAAGAAGTAGTGGTGAAGCGGATATTGGAGGAAGA
AGGAGATTTAAATGCTAAATCTGCCGAATATGGCACAGCGTTAGATGTGG
CAGCTCTCCGGGGACATGCGAGTATAGCCAGGATGCTAGTGGAGAGAAAC
GTTGTTGCTTATATATACGGGAAGGAGGTTAACATCTTAAATACGAAGAG
AAGCGAGCTAGAAGGTGAAGAAGAAGTATGTGATCATGGTCAAACACGGT
TCGACCGCCAGGGAATTAGTGACCTCAGGATCGCTGTGTCATGTAGGAAC
TCCGAGAACGACTACGACAAGAACTCGTCGTCGAAGAAGAGCTCCTCCTT
GAAAGACTCCAACGAGAAGAAAAACGAGAACTCGTCCTCCGACTTCTCGT
CCTTCGACGAGAACGATTTCTCCTTGTCAGGCGTCGTGTCGTAAGTGATC
ATGATCAACCACGGTTCTGGCACGAGCAACGTCGAGAAGTGATTGCGTTC
CACGCTGTGCACCTCTCCAGGATTTTCTTAAGCCTCTCTGCATCCAGGAC
GTGCACTATCCTGGCACGGTACCTTTACGGCCCGGGCATGACCGCCTTGT
CCTAAGATGAAATTGCTATTTTTCACGCAATACTCCCACCACACTACCCT
TTTCTACCACTCTCTTATACACCGGCTGGATGTGGTCATTACGGATATGG
AACATTGTGGATGAAAAGAGTTGGCGGAGTGT

Sequences in the Contig:

SY0AAA44YE10FM1 SY0AAA56YI09FM1