Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1187
Length(NT) : 725
Best Gene Model Blast : Link to GSTUMT00007622001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_06797
Accession: ref|XP_001554654.1| Score: 303 E_value: 5e-26
KEGG Definition: hypothetical protein
Accession: fgr:FG09002.1 Score: 303 E_value: 2e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O14341|RM35_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1187
TTGGCAAAACAACCCCCCACCACACCTCCGCAAAGTGTCGCAAGGTCCCT
GAGACAACCACTGGAAGGATGTCTACCAGGACACTATCGGCGAGCTCGTC
AACAAGGGCCTTAGGCGTACCCTGTTTCAATGTTCTTCGACCAATTACCC
TTCGGGGTCTCCGAACTAAGGGTATTGCGAGCGAGAGAGGTGCTAGGGGT
GTCGAGGGTGTCGAGAGTGCTGAAGGAATCAAGGGAGGCGGGCCCAGGAT
GAGGACTATCGAGAGAATGCCGTTCCAGACATACCAGCTCGCCCTGGATA
TAATCAACAAGGACCGGCAGGAAATGCTCAAAAGAATCAGCGAAGAGAGG
GAAACAATGAAGAAATTGATCAAGTATAAAGGACTCACGCACAAAGATCG
GCGAATCATCTCCATGAAGCAACAAATTGAGAAATGGCAGCTATACGCTG
ACGCGAACAACCCGCGGGTAAAATATAATTTTGATTGTGGGAAAATTGGG
ATGAACAAGCCGATATACCTACATCTTCTCGACAAGAAATGGAGGCAGCG
GAATCGACCGATCCTTATGCAAAGACTTGAGACCATGCATGTTATTCCAG
ATGTTCTCCCAGACATTAACCCTATTGTCGATGTGCGGGTGCACTTCAAA
GGTAGAAAGGTCCAGCCTGGACTGGTGTTGGATTCTTTGATGGTGGAGGA
GTGCCCTACCGTCAGAGTTATTCCC

Sequences in the Contig:

SY0AAA44YE09FM1 SY0AAA58YI21FM1 SY0AAD51YI19FM1