Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1186
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00007499001 E-value : 1e-125
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein AN3439.2
Accession: ref|XP_661043.1| Score: 178 E_value: 2e-26
KEGG Definition: hypothetical protein
Accession: ani:AN3439.2 Score: 178 E_value: 9e-27
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3012 Score: 186 E_value: 4e-15
PFAM Definition: UNC-50, UNC-50 family. Gmh1p from S. cerevisiae is located in the Golgi membrane and interacts with ARF exchange factors..
Pfam Number: pfam05216 Score: 188 E_value: 2e-15
Swissprot: Q9VHN5|UNC50_DROME
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1186
TTGGCAGATAGCGACTTCACAACGACACATCAAGACATCACTGCACAACG
TCATCACGATTCTCAACACTCGGTATCCTATCACTATCACACCCTAACAA
CCTAAAGACCGGGACGAGAATGTACGCACCCCGTACTTCACCTCCGCCCA
CGCGATCAACCTTCGCTCCACATATCGCTGCCCCACGACATGGTGGTCGC
TCGGATTCTAGCTCGGGTTCGCGACTACCGTTGTTCTTTCGAAGAATGAT
CAAATTCCCTCAGATGGACTTTGAGATGGCGATCTGGGAAATGACATATC
TGATAATGGCTCCTAAGAAAGTCATCCGAACAATATACTATCATGTAGGA
AATCCCGGTTCGATGTGCTATAGAGAACGTTATTGACCGACGGGTTTCTT
AGAAACAAACGAAAAATACCTGGTCTCGCGATGACCCGTCTTTCATCGTT
CTCCTCACATTTTTCCTAACACTCACTTCCCTTGCCTGGGGGCTCGCATA
TACTCCAGCATTCGCTTCGATCATGAGATTGATATTTTCGCTAGTATTTC
TGCACTTTTTGCTCACTTCCGTGATATTCGCATCGACAGGCTACATAATG
TGCGGGAGGTTTCTGAAAGTGCCGGG

Sequences in the Contig:

SY0AAA44YD21FM1 SY0AAA52YA14FM1