Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1185
Length(NT) : 738
Best Gene Model Blast : Link to GSTUMT00001461001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1185
TTGGGGAGCTGAAACCACTCGGACAAGAGTCCTTGCCGTCAATAATTCGA
GCCCCCCGGCTGAGAGTGTTTCTCGAAGTAGGACCGAGAGCAGATCTGGC
AGTGAGGGTGGGAAAAGAATGAGGGATCAAAGCAGAACCGACGAGGAAAT
ATCTGAAGAGGCTGTAAAGAAGAAGCTCAAGCTTCATGAAGAAGCTGTCG
GAAATGGGGTTGAGGTGCCTGAAAATAACTCTTCAATGAGGGGGAAAGAG
AAGGCACCGCCGCCCCCACCACCCCCTGAGAAACCTGAGAGTGGTGAGCT
CGAAGAAGGAGAAGTGGATGACTAGGTGTATTATGACCCCTCCCTCCCAC
CCCCTATCTATATATCTCTCAGGAAGAGTGAGAGGATGTGTGGGTTGACT
TTGCTCTTTCATGGCTTCCTCCTATCCATCCCTATCATACTTTGCTATCC
ACCCCTTCCTTTATACAATTCTCTTCTCTTTTGTCTCCCTTCCGCGTCCA
CCTCTTTGGTGTACCCCCCCCTTCTCTCGTAGAATGGACTACCTCTGCAC
ACCCGCCTACACAAACAGGAAAAAACGCGAAGCTTGACTACCAAAAAAAA
AATAAACATATCCGCTCGTAATCCTTTACCCCCGGCTCGGTTGTAATACT
TTATTAATCGGTGATTGGAGTTTTCCTTTTCCTCTTCTCCAACCATTCAG
TCTCCTTGTTCTCACTCACTCTATTTCCATTCTCCTTA

Sequences in the Contig:

SY0AAA30YD03FM1 SY0AAA44YB19FM1 SY0AAB1YB08FM1