Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1184
Length(NT) : 1208
Best Gene Model Blast : Link to GSTUMT00008071001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein MGG_13438
Accession: ref|XP_001409508.1| Score: 1078 E_value: 1e-115
KEGG Definition: hypothetical protein [EC:3.4.13.9]; K01271 X-Pro dipeptidase
Accession: mgr:MGG_13438 Score: 1078 E_value: 1e-116
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2737 Score: 830 E_value: 2e-89
PFAM Definition: Peptidase_M24, metallopeptidase family M24..
Pfam Number: pfam00557 Score: 453 E_value: 1e-45
Swissprot: P43590|YFH6_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig1184
TTGGGGATGAAGTCCTTCCGACCTCATCCACGTCGTATTTCTCTAGTGCC
TCCGAGTTAGAGAGCGGAAGTCCGGACCAGAGAAATACGACGTGGATGAA
GTCCTTCCGACCTCAGCTACGGCCCTACCAACCACATCCTACTCTAGCCT
AATGTTTGTAATCGAGAGCCAAACTTCGCGTACCTTTCACCTCCAAAACA
CCGAGAGCTTGGAGCCAGCTATCGAGCGCGCGCGCGCAATCAAAGACGAA
TACGAGGTAGCCCTGATCAAGAAAGCGAACCGAATAAGTGCACTCGCACA
CCACTCCTGCCTTCGCGCAATCAAGTCTGCCGGAAACGAACGCGAGATAG
AAGCAGTCTTCACGAAGGAGTGCATCGCAAACGGTGCGCCAAAGCAGGCG
TATTCCGGAATCTTTGGCAGCGGCAGGTCCGCGAGCACCCTGCACTATGT
GCACAATAACCAACCACTTGCCGGGAAACTGAACTTGCTATTGGACGCTG
GGGCAGAGTACAACAACTACGCTTCAGACATCACTAGGACGTTCCCGATA
TCCGGGCAGTTTACCAAGGAGAGCAGAGAAGTCTACGACATCGTACTCGA
TATGCAGAAGCAGTGTCTCGCCGCTTCCAAGGCGGGCGCCGTCTGGGACG
ACATCCATATCCTCGCGCACAAAGTAGCAATCCAGGGTCTTCTCAAGATC
GGTGTTCTTAGGAATGGCAGTGTGGACGAGATACTGTCCAATAGGACCAG
CACTGCTTTCCTCCCGCATGGGTTGGGGCACTATCTTGGTATGGATACCC
ATGATTGCGGCGGGAACCCAAATTACGCGGACCCCGACCCCATGTTCAAA
TATTTGCGTAAGCGCGGGCCACTTCCTGCCGGTGCGGTTATCACCGTAGA
GCCCGGGATTTACTTTTGCGAATTCATTATCAAGCCGTACCTTGAGGATG
AGAAACATGCCAAGTATATTGACAAGGACGTTCTGAATAGATATTGGGAT
GTTGGAGGAGTTAGGATTGAAGATAACATCCTGATCACCGAAGGGGGATA
CGAGAACCTTACTAATGTGGCTAAGGAGGTTGATGATATGCTGAAGTTTA
TTAATGGATAGACTTGCAAGGGATATGAATAGACCCTGTACTTTTCGGTC
ATGTAGACAGGGATCCATTGACTGTCCCAGCATGTGAACCAGTAACCATT
CCGATAGA

Sequences in the Contig:

SY0AAA44YA19FM1 SY0AAB56YJ14FM1 SY0AAC17YL13RM1
SY0AAC32YA09RM1 SY0AAD53YL03FM1