Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1183
Length(NT) : 1314
Best Gene Model Blast : Link to GSTUMT00005928001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1183
TTGGCAAAAACTACGAAGAGGCCGAGGCAGCCGGAGAAGCCAAAGCAGCT
GAAGAAGCCAAAGCAGTCGAGGAGGTCGAATTCAGAGCAGTTGTTTCATA
ATAGGCCTGGCCCATCCCCACTCCCTTTGAGGGCCAGTGTTTTTTCGAAG
AGGTTCGCCGAGATGCATACGAACTCGATGTGGGTACTTCCTAGCGGGGA
TCTTGCTGAACAAGTTCTCTATGAGGGACACAGAACTACCCCCTATGAGT
GCCTACCGCATTCATTCATCATTGATCTCGCTGATCCTACGGTCCAGAAA
TTATATAAGCCGAAGGATTGGGCGGCGATTTGTGAGAGGGTGCCAAAATT
GCCGGAGAAGGATGAGTCGCTGGGAGAGGTGATGAGGAAGTTTGAAAACT
TGGAGTCACCTGAGCAATTACGACGCGTTCTAATCGAATCGAGTTACGTA
CCAAAAGTCGAACTCTACGACCATGATATGCACTATGATGCATCTTGGGT
TCATTTGGTTTTCGATTATCTCCTCCCACTTTACGACAACCCAGATCCAG
TCCTTTTGGAAGATCATCCTGAAGCCTGGTTTGATATTAACATCTGGTCG
GTCGTGGTTGATCGCTGCCTGCAGGGTCTTAGAGGAATCAATATGCTTCG
TAAGGAGACAACTTCCTTGGCCGGCTCTCTTAGGAGAAACCGAGACAGAA
CGTATCCAACGAAACGACAGAAGATGGGCCCACGTTATGACGGACTTGCC
ATGGACCGTAGCAATCGCATTGAATATGCCGTGATGGAGACGTCCAAGGC
CTTTCACCTTGAAGGTGCGACCAAATGGCTTCATGATTATCTTAAGGTAG
CAAAATGTCTCCATGACATATTATTCCGTCTGCATTGCGAAGTCAATCAT
GAGGAATCTCTTTTGGACGAGTTACAGGTGGCTGGGCTCGTGAGTGCGGG
GTTGGATTGCCAAGTTCTACGAATGAGCTATGGAGGTGGTTATGTGTGCA
TTCTGAGTCGAGATAAACGGCGTACGATTCCTGCAACATTATCGAAATCG
GGGCAACTTTTGAAACTGTTGTTCAGTATTTGGCGGTTTAAGATGATAAT
AAAAAATTGCAAGACAATTGTCGACTCTTGCGGCAAAGATGACACAGAGC
AAGACAGTCATGCGAGATTAATGTCATCACCTAGCTGGTCATACCCTAAA
ATTCTGAGGGCCTTTGATACTGAGACTGAGGGTGAATGAATGATAATGCT
TTAACGATTTTGATAATATAATATATTGGCATGAGCCTCGCTGGCTCAGT
AATGTTTTGTTGTG

Sequences in the Contig:

SY0AAA14YC13FM1 SY0AAA43YP21FM1 SY0AAB51YE12FM1
SY0AAB61YB13FM1 SY0AAC17YB18FM1 SY0AAC17YB18RM1
SY0AAC20YF01FM1 SY0AAC20YF01RM1 SY0AAC27YE17FM1
SY0AAC33YB22FM1 SY0AAC57YK01FM1 SY0AAD43YB16FM1
SY0AAD5YA13FM1 SY0AAD63YE09FM1