Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1182
Length(NT) : 1192
Best Gene Model Blast : Link to GSTUMT00007464001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: aureobasidin resistance protein Aur1
Accession: ref|XP_001263463.1| Score: 949 E_value: 1e-100
KEGG Definition: aureobasidin resistance protein Aur1
Accession: afm:AFUA_3G09960 Score: 945 E_value: 1e-100
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q10142|AUR1_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0009826 = Biological process: unidimensional cell growth

Sequence:
>Contig1182
TTGGGTTTCTTTCTCTTGTTCTCTTTCTTCCTCTTCCCTTTGCATTCGCC
CGTCTCCCACCTTCCCGTGCGCCCTCAAACTCCTATTCTCGCTTGCGAAG
AAAGACCCGTTGATCTTTCTTCGCTCCCTCCTCTTTCTAACTCTCCCTCA
TCTCGTCTACTGACGGAGCGTTGTCTTCTGTGTAATCAGCTTTCGACCCT
TCCTCTCACTAGAAGTTCCTCCTTCCTCCAGGCCGTCGCGGAAGCCTCAT
AAACGCGACACTTCGCCCCAAACCTTCCAGGACCTTTCTTTTGGCTCACA
GCGCCTCACAACATGAAGTCGCCCGCATCAAAATTGTTTCCGGGAATGCT
GGATACACATCCATCTTTCAAGAAGCAGAGTCTTATGGGTTGGCCTTCGA
TTCCGGGCTTCCACAGGGTTCGAAGGAAGTTTGCATCTCGGATGAGGAGT
GGACAGTCACCAACCTCGAATCTCTCGACATTGCAAACATCCTACGATCC
TGCGGACACCATTCGTGCACTCAGGGCTCACCGCTGGAGTTATTGGGATG
GTCAATACCTATTTCTCGTCATCTTGGGGATCTTCTGTTTGTCCATAATA
GAAACGCCGGGTGCGATCATCAAAACCTTAATTTCCACCCTTTTAATAAC
CTCTCTTATCTTGCCCATCACACGACAATTCTTCCTGCCATTTCTACCCG
TTGCTGGATGGCTGGTCTTGTTTTATGCATGCAGATTTATCCCCTCGGAA
TGGCGCCCTCCCATCTGGGTTCGTGTGCTTCCCGCTCTTGAGAACATCAT
CTACGGTGCCAACCTCAGCAACATCTTGTCAAAAAACACCAATGCATTCT
TGGATGTTCTTGCATGGCTTCCCTATGGTGTTATTCACTTTGGTGCACCA
CCCGTCTGCTCCGCCATCATGTTTATCTTCGCGGCTCCCGGAACCGTCCC
TGTCTTTGCCCGCAGCTTTGGTTACATGAACATCATTGGTGTTGCCATCC
AATTGATGTTCCCATGTTCTCCACCTTGGTATGAGAACCTTCACGGGTTG
GCTCCTGCCAATTACTCGATGCCAGGGTCACCGGCGGGTCTTGCTCGTAT
TGATGAGTTGTTTGGCTGGAATACTTACACCTCCACTTTTACTGCTGCTC
CGTTGGTCTTTGGTGCCATGCCATCCCTACACGCCGGCTGTG

Sequences in the Contig:

SY0AAA23YH04FM1 SY0AAA43YM08FM1 SY0AAA43YP14FM1
SY0AAA46YJ16FM1 SY0AAA52YB16FM1 SY0AAA60YH20FM1
SY0AAA61YN01FM1 SY0AAA63YG02FM1 SY0AAB22YL13FM1
SY0AAB40YM12FM1 SY0AAB6YI16FM1 SY0AAC62YM09FM1
SY0AAD30YH08FM1