Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1181
Length(NT) : 918
Best Gene Model Blast : Link to GSTUMT00006375001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SNOG_12593
Accession: ref|XP_001802814.1| Score: 191 E_value: 7e-13
KEGG Definition: hypothetical protein
Accession: ang:An04g06990 Score: 144 E_value: 1e-07
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2431 Score: 116 E_value: 1e-06
PFAM Definition: Glyco_hydro_47, Glycosyl hydrolase family 47. Members of this family are alpha-mannosidases that catalyse the hydrolysis of the terminal 1,2-linked alpha-D-mannose residues in the oligo-mannose oligosaccharide Man(9)(GlcNAc)(2)..
Pfam Number: pfam01532 Score: 119 E_value: 4e-07

Sequence:
>Contig1181
TTGGAGCGATTTGAGTTTTCTCGGACGAACGAAGCAACGCCGGCCGAGCC
GCTGGTTGGACAGAACAAGGAGCAGTTGCTCGCTGGAACGTGGGCGGCGG
TGAGGAGAGGCTGGAGGGTAGGAGTGTTGGCGGAAAACCTACGGTAGCAA
TCCAACCAGAACAAAGGGTCCAGCAATTTTCTAACCAAGGAAGGAAGTGT
ACTTACTTGTATGTAAGTGGAACGGGAAAGGGAAGGAAGGGCGCGGTGGG
GGTTTGGTTGGAAATAAAGGAGAAAAGAATTGCCCTTTTCTCAAGAGGGC
CGTGGTTCTTGCGTTGTCCACCACACAACGATTCGATAACGATACGCTGT
TTTTTTTTTCTGCTGGGATCGTTTTACGGCAGGAAACGCAGACAGACGGA
CAGACAAAGACCGTGAGGGAGAAAGGAGTTAAGGAGAGGAGAGAAGCCTT
TTTCCACACAGAGACGCGCAAAATTATAGGGAGAATGATCAGGCCGGCAA
CTCACAGAACGAGGTTTTTGATTCTGGCGTTTATCGTGATTATTTACTTC
AACTACGTCATCTCGCCAGAATTCGGGAATGGTGGCTCCAGCTTTGAACT
AAACCACCCTGGATCATCATCAAGACTCGGTATATTCGGCGGCGGTAGAA
ATGGAGGGAGAGGGAAGGGGGGTGGCCGATATGGGAACCCCATACAATTC
GATTTCAAAGGCAGTGGTAGAGCTGCTGGGGATAGCAAGCGGGCCGGTGA
GATCAAGGAGGCCATGAGCAGGACCTTTTGGAAGTATAGGCTTGGAGCTT
GGGGTAGCGATGAAATCATGCCGATTAGTGGGAATGGGAAAACTACGAGG
AATGGATGGGCAGCGACTATTGTGGATACCTTGACGACGACCGCTATGAT
GGGCCTTGAGGAGGAGTT

Sequences in the Contig:

SY0AAA3YI06FM1 SY0AAA41YI13FM1 SY0AAA43YP01FM1
SY0AAB12YP08FM1 SY0AAB19YC13FM1 SY0AAB24YD21FM1
SY0AAB29YD23FM1 SY0AAB50YD19FM1