Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig118
Length(NT) : 1432
Best Gene Model Blast : Link to GSTUMT00009491001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: hypothetical protein An12g03960
Accession: ref|XP_001395470.1| Score: 757 E_value: 3e-78
KEGG Definition: hypothetical protein
Accession: ang:An12g03960 Score: 757 E_value: 2e-78
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG2848 Score: 680 E_value: 6e-72
PFAM Definition: Acyltransferase, Acyltransferase. This family contains acyltransferases involved in phospholipid biosynthesis and other proteins of unknown function. This family also includes tafazzin, the Barth syndrome gene..
Pfam Number: pfam01553 Score: 347 E_value: 3e-33
Swissprot: P33333|PLSC_YEAST
Gene Ontology:
GO:0005811 = Cellular component: lipid particle
GO:0003841 = Molecular function: 1-acylglycerol-3-phosphate O-acyltransferase activity
GO:0030148 = Biological process: sphingolipid biosynthetic process

Sequence:
>Contig118
ATTTCCCCACCAAAATTTTCATTCCTTTTTTTTCTCTTTCTTCCGATTTT
ACTGATCATCTTTTGCTCGCCAAGACTGCCTGGTCGCTCACTTGACACTC
AACAACCCTCTTCCTTCTCGTTCTCCCGATTGTACTGTACCCGTACAAAA
GTGGATCACGACGGCAGCGGCACCCCCACGACGAAAAGTTTGCTCATGAG
CCCGAGACAGCGACACATGGCCGTGATAGTTGACCCCCCAAGAACAGACT
TATAGGCCCTACTTCCCTCCATCCACTATCCATCCATCTGTGATCCCTTT
TCGTTACGAGGTACAGTAAACAGCAACAGATCGTCACCTAAATTACTCTA
CCCGAGTACACTTCGCACTTTCCTTACCTCCCTCCCGCCTAACCTTGCTC
ACCCCTTTCCCTTTCTCCGCCGCCCCGATAGAAGGTAATTATTATGGTCA
ACCTCCTCCTCGTCTTGTTATTCCCCATCGGTATAATTATGGCCTTGACG
ATCCTGGGCCGTTTCTTCAAGACCGGGCGATTCTACGCACGTATTCTATC
CTGCTATTTCCTCCTGGTCACATGCGCAGCATACGGGGTCCTGGCGTCGG
TAGCCCTCCGGTTAGTGGGAAAAGTCAGCATAGCACAATGGACCACTGCA
CGAGCGTTCAAGAATTTAGCCTGCCCGGTCATCGGGCTAGAATTCAGGGT
GGAGAATGAGGGTGCATTAGGCACTCGACCGGCGGTGTTCGTTAGCAATC
ATCAGAGCGAGTTGGATATTGTTTTCTTGGGGAGGGTTTTTCCAAAACAT
TGCTCGGTTACGGCGAAGCGGAGTTTGAAGTATATTCCGTTTTTGGGATG
GTTTATGGCATTGAGTGGAACGGTGTTTATTGATAGGACGAATCGGAAAT
CAGCTATTGCGGCGTTTGACAGTGCGATTCGGGAGATCAAGGGGAATAAG
CAGTCTGTTTGGATTTTCCCGGAAGGCACTCGATCATACTTTTCCAAGCC
GGAACTCCTACCATTCAAGAAGGGTGCTTTCCATCTAGCTATTCAAGCCG
GCGTTCCTATTGTACCGGTTGTCGTCGCAAATTACTCCCATATCTTACAC
CTCCAAGAGAGAACCTTTGAGCCTGGTGTTATCAATGTTAAGGTCTTGGA
TCCAATTGATACCAAGGGCCTGACAACCGATGATGTGGACGCACTGGTCC
TGAGTACAAGGGAGGATATGTTGAAGGAGCTGAAACTCGTCTCGGCCACT
AGCGCAAAGGCAGAGAAGTCGCAATAGAGCTTCATGCTCATCCAAGCACA
GCACATTTGGGGACTCCAGATAGCGAGTCACTCTCCTGAAAAGAACAAGG
AAATCGTGTATAATGGCGCAAGCAATAGTATAGCATGGAGTTTCTTTCCT
CTTTCTTTCTCCCTTCCATCCTGCATCCCTCC

Sequences in the Contig:

SY0AAA14YG14FM1 SY0AAA38YF16FM1 SY0AAB10YB17FM1
SY0AAB14YN14FM1 SY0AAC1YF14FM1 SY0AAC26YC22FM1
SY0AAC3YL15FM1 SY0AAC55YG17FM3 SY0AAC55YL14FM2
SY0AAC61YF08FM1 SY0AAC61YP23FM1 SY0AAD16YF20FM1
SY0AAD16YK06FM1 SY0AAD17YC08FM1 SY0AAD43YA16FM1
SY0AAD49YG19FM1 SY0AAD4YE03FM1 SY0AAD58YN21FM1