Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1179
Length(NT) : 1131
Best Gene Model Blast : Link to GSTUMT00004383001 E-value : 0.0
Numbers of ESTs : 22

Blast Results:

Nr Definition: hypothetical protein An14g04100
Accession: ref|XP_001401034.1| Score: 274 E_value: 2e-22
KEGG Definition: hypothetical protein
Accession: ang:An14g04100 Score: 274 E_value: 1e-22
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1773 Score: 188 E_value: 5e-15
PFAM Definition: UPF0057, Uncharacterized protein family UPF0057..
Pfam Number: pfam01679 Score: 159 E_value: 1e-11

Sequence:
>Contig1179
TTGGGGTAACACAACAGTCGGCTGACGACAACTCTACCTTCCCTTGTTCA
GACCATCGCTTTTGCTCTTCAACTTCGTATCTCTCAGGTACAATAATCCC
ATCTCGCAACTGGCCACGTCTATTTTACTTCTCGTCTCCCCTCATCCCTC
TGACTCTCCTAAAACGCCGGTAGTCTTCCTCCGACCATCTCCAAAAGAGC
CCCACATCTCTCACACACTGTTCCTCTCTCCAACACGCCATCGTCTGCAT
CCGAGTCAGTGTAGACGACAGTCCAGTCACCGGCTAGATCATTACAAGAA
GAGAAATACCTTTCTAAAGGAGATAATGTGTTCCTCTGATTGTTTCTTGG
CCGTTTTGGCCGTTCTCTTCCCTCCACTTCCTGTCTGGGTCAAGCGTGGT
ATTTGTTCAGCAGACTCTCTTATCTCATTAGCGTTGTGTTGCCTTGGATG
GTTCCCCGGTCTCATTCACTCCTGGTACATCATTTCAAGATACCCAGACC
CATGGGATACCGCTTACGCGCCGCTCGCTCATGAATCGCAAGGCACTGCT
TACTACTATCATCAAGTCGCGCCCGCTCAACATCCTGCTCATTCCTGCGC
TCATCAGTCACGTCCCCAGTATCAACAGCCAAATCCCCAGTATAGCACCT
TCCGAGGCGGGCCCCCTAAGCCCGCACCTGCTGAGAATAGGCAGCGACAA
TATACTGTGATTCAGCCCGTTCCTGCATCTCCTGCCCCCGCTGGAAATAG
GCAACCGGAGAGGTACACCAGCCACGAGCAACAAACTCCTCCAGAAACAC
CAATGAATGGCCTTGGGGGCGAAGGAAGTAGCATGCACATCCCATCTGGC
GAACCGCCTAGCTACGCCAGCATCGTTCAGGGCGATCACAAGATCCAGAC
AGATGATTAGGAATAGGGGAGCAAAACTGTAGATTAGATGAAGGGTGGTG
GGTACTCGGGAAAAATTGATCTCTTTTCTGCTTATGTTTGCCTTTTTATC
TCTTATTCCTTTGGAGGGTTTCAGATTTCAATTCTTTCCCCCGCTACTGT
TTGATCTCAGCTACCGCTGCTGGGGCAGATGGGGGTTTTTAATGGTGTGA
GAACGACGATATGTTCTATGATTTGGGTTTT

Sequences in the Contig:

SY0AAA10YC18FM1 SY0AAA12YN14FM1 SY0AAA43YO16FM1
SY0AAA44YD14FM1 SY0AAA9YI15FM1 SY0AAB13YF01FM1
SY0AAB13YG18FM1 SY0AAB13YJ14FM1 SY0AAB13YL10FM1
SY0AAB1YD18FM1 SY0AAB32YH22FM1 SY0AAB36YM09FM1
SY0AAB52YE01FM1 SY0AAB55YB10FM1 SY0AAB56YC24FM1
SY0AAB5YH07FM1 SY0AAB9YK22FM1 SY0AAC46YA12FM1
SY0AAC58YJ16FM1 SY0AAD59YF19FM1 SY0AAD5YO14FM1
SY0AAD60YH24FM1