Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1178
Length(NT) : 765
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1178
TTGGGTGAACGCGATCTACCACGGTTCTGGGACGATCCAATTGCTGACCT
CTGGCTTGCTGAGTGTCGTAGGCAGAATTTGAATATGAATATTTTGTAAG
TGAACGGGATCACCCACTGTTCTCGGACCAGAATGCTGCTAAAACAGGGC
TTCTTCCTTCCCCCAGGCAATTGTTTGTCACCCACAACCGTTAAGGCTCC
CGTTAATGTTCCTAATTCCTGACTAACTTCGCACGTACTTCCTGCAATAG
AAGTTTGTATGCAAAGCTCTCTCCCTTCTTCGCCTAGCAATTACTGAATC
TTATTTGGTATTGTGTTACAGCTCATAGTGAGTACTACGATTTGACTACC
ACTAACTCTGCCCTCACAGGATATCTGTTAACCTTTCTTGTAGCCTTTTT
GCATCCCGGATGAATCGGATCCACCCGCCACGCCCGACCGGGGCACGACC
TCCTCGTATAATAGCTCTAGTTTGGTGTCCAACTAAGTGTCTATAATGGG
TTATTGCTTGGAGGCCTATCGCTCCATCGATACGTTTACCAGTTCCCTAC
CCCACCGCCGCCTTTTCGCACACCCTACCCGGCGAGCTGTTGGTGAGATT
TGTTTCAGTACGTGGTATGCTCTTGGTATTAGGATGTAGGGATTTGCGGG
AGTCGGTTATAGGTTTTTGTGCGGTGTTTCTGTCCTATCGTGTTGATCTC
TCTATTACTATATATATGCACTGTCTTGTGATTTTCCAAATGAAATATCT
GATAATCTGAGAAAA

Sequences in the Contig:

SY0AAA40YG12FM1 SY0AAA43YO14FM1 SY0AAB46YG05FM1