Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1177
Length(NT) : 1413
Best Gene Model Blast : Link to GSTUMT00011974001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0307 Score: 167 E_value: 2e-12
PFAM Definition: Herpes_BLLF1, Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220. It is the most abundantly expressed glycoprotein in the viral envelope of the Herpesviruses and is the major antigen responsible for stimulating the production of neutralising antibodies in vivo..
Pfam Number: pfam05109 Score: 143 E_value: 1e-09

Sequence:
>Contig1177
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGCCGCTGCTCACTCTCCCACAGAACAAGCCGAAGCCAACCGG
AAGAGGCCAAAGCTTGAGAGCGTTTCAACTACTAGCGCTATGGGGTCTAC
TATCACTAGCAATTCAGTTAGTATGGCGGCCGGGATAAATGCGACCGCAC
CTCCTGTGCTCGCGCTTGGTAGAGGAAGTGGTCCTACCGGTTCGGGTACG
GCTACATCTTCTGATCAAAGTGCCTATACATCCCCTTCTAGCCATGACTC
GGGCACCCAATCTATGACACCCTCGACATCGAGGGCGTATCCGGTTTCAC
CCGTGCGCCGTTCCAGGTCGCCATCTGATGTTGCGCGATACAGAGACGCC
GTCTTGAGGTCCACCCAACAGCAACAGCAGGAGGCATTTGTTGCACCCAC
AACTGAGCCCGAGTCTCCTTTCTTTACCCGAATTCATCCTACTATCCAAA
GCCCCCACATTCAACAGCAATCTTCATTCATGAGGCATCAACCGCCTCCA
CTGGGCGCCCAACCTATATCCAGGACAGGGCCGCCTATGCCGAGTCCTGC
GATGAGAAGGGCTAGCTTACGGTCCGACGAAACACTGCCTCCTACTCCGG
CTTCCATGAGTAGCGGGAGTTCCTCGGCACCCTCATTAACACCCTCTGTT
TCTTCTTCCTTCGATGACGGCGGCCGCTCCCACCGCGCACTTCCTTCCCT
ACCCCCACCTACCCCTGGGCCCTCTGCTGGGACCGGATATTTTGACCAGA
AGTCGCATCGACCTTCTGCACCGCCCACACGTTCACCCCGCACTTACCAG
CAGAGTCTTCCCCCGCCGCCAACTCCAGCGAGCATATCACCGTTCCATGG
CCACCAGGCCGCAAGCTCTCATGCGTCGTCGACCCCGGGTCAATTGGGGT
CAGAAAATATGAATACTTCAGTTGGAGCAAGCGCAGGAGCTCTGGGACTC
CAAGCTACAATTACGGGAAGCCATGCGCACGCCTCGTTTGCGTAATGGCA
TCTACACCACCAAAACGATATATCTTCAACACATTTTAATCAAAGCCAAG
GGGTATCCACCTGATACAGAGCTCGTCTCGCCTTTTGCGGAGAGGCTGGT
CTCCTTTCTAACCTTATCCTCACATCGCAGCATCTCATTATTCCCATTGC
ATTTTTCCCCCACCACTGTCTTCCACGCGCTGTTTTGGGCGTGGGCTTCT
CCTCACACGGGCGTTAACCAAGCATCTATTGTTGACTACGAACAATTCTT
GTAAAATTGACCTTTCATCCTTTTCTTTCCCACATTGGTACAAAGCGTTT
ATATCATGCCCTCTTTTTTATACTCTATTCCCTCCTCTCCAACTTCGTGT
AATTCGATTTTAC

Sequences in the Contig:

SY0AAA43YN16FM1 SY0AAC16YK17FM1 SY0AAC48YA10FM1
SY0AAD10YO08FM1 SY0AAD24YO15FM1 SY0AAD47YE06FM1