Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1176
Length(NT) : 1744
Best Gene Model Blast : Link to GSTUMT00001611001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: hypothetical protein SNOG_15244
Accession: ref|XP_001805401.1| Score: 706 E_value: 3e-72
KEGG Definition: hypothetical protein
Accession: ncr:NCU03207.1 Score: 687 E_value: 3e-70
KOG Definition:
Classification: [RNA processing and modification, Nuclear structure, Signal transduction mechanisms].
Kog Number: KOG1909 Score: 795 E_value: 4e-85
PFAM Definition: No Hit Found
Swissprot: P41391|RNA1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0031965 = Cellular component: nuclear membrane
GO:0005098 = Molecular function: Ran GTPase activator activity
GO:0030702 = Biological process: chromatin silencing at centromere
GO:0007059 = Biological process: chromosome segregation
GO:0051383 = Biological process: kinetochore organization and biogenesis
GO:0006913 = Biological process: nucleocytoplasmic transport
GO:0031291 = Biological process: Ran protein signal transduction
GO:0007346 = Biological process: regulation of mitotic cell cycle

Sequence:
>Contig1176
TTGGCTCCCATCCCTCTTCTCCTCCCTCCTCTTTTCACAACACCACCACC
CCCACCCACCCACCTGTCTTACCCCTAGTGAAGAAGGCATTATTTTCACC
AAACAAGTCTTGAGGCGGCACAATGAGCAGTAAGGTTTTTATTCTCAAGT
CTAGGGACGGGAAACCCCTCAAATTAGACACCGCTGCCGACATTGAACCG
CATATCGCTTCCCTCGAGGGCAATGAGACGGTGGAGGAAATCCGACTCTG
CGGCCACACATTTGGAATCAAAGCCTGCAAGGCACTCGCAGAGGTCCTGA
AAACAAACAAGAATCTGCAGGTCTTCAACGCAGCCGACATCTTTACCGGC
CGCCTTATCTCTGAGATTCCGGACGCACTTTCAGCGCTACTGACAGCGCT
CTTGACCCTTGAGCATTTGCATACCGTCGATCTCTCAGACAACGCCTTCG
GGGGCCGTCTTGCCGATACTCTGGGAGATTTTTACGCCCGGGCCGGTCCA
TTACGGCACTTGTTGCTGAACAACAATGGTCTCGGTCCTGCAGGTGGCAT
CATAGTCGCCAACTCGATTCGTCAACTCGCAGTTCTCAAAGCCTCGACCC
CGGCATACCCTCCCCTTGAAACCATCGTTTGCGGTCGTAACCGCCTCGAG
AATGGGTCCATGGCGGCATGGGCAGAGGCTTACGCCGCGCATAAGTCGCT
GAGGACAGTCAAGATGGTGCAGAACGGTATCCGACAGGAGGGCATCAGCG
CGCTCTTGAGAGATGGCCTTTCGAAGAACCACGGGCTACAGACTTTGGAC
TTGCAGGACAATACGTTCACAGCAGCAGGGGCCTATGCATTGGCAGCCGT
TGTAACGAACTGGAGTGACCTACTAGAGCTAGGGGTTGGAGATTGTCTAC
TCTCTGCCCGGGGAGGAGTATTGCTAGGGGAGGCACTAGGACTAGGGAAA
AATAAAGCGCTCAAAACTATTAGACTTCAGTATAATGAAATCGACGTTAA
AGGTGTTGAAGCTATCAAAAGGGCTATCAACCCTTCTCTCCCGAAACTTC
AACGGTTAGAGCTTAATGGAAACAAGTTCTCGGAGGATGAGTTAGTCGTC
GAACAAATGCGAGAAATCTTTGGAGATAGAGGATTCGGCGAACTAGATTC
CCTTAGCGATATGGAGGAGGAAACCGACGAGGAGGACGAGGAGGACGAGA
GCGATGAGGGCGAAGACGTCGTCAAACAGGCCGAGGAAGCAGAGGACGCA
AAGGTCCCACAGGAAAAGGACAAGAAAGTCGATGCCCTCGCGGACTTACT
CGATGGAGCAAAGATTGCATAAACAAAAAAAAAAAAAAAGGTTGCACCCG
AATCTCGTATGAATACTAGGTTGAGGCAAAATTTCCTCTTTCTCGTGTCA
TCGGGGTGGGCACGGACGGGGGAAGATGGTGTTCGTGTTTTGTCTTGTCC
ACCTTTCTCTCCTTAATTCCCTACTGTATCCCAATAAAGCCGGATGGCGT
TCTTTGTTACTCAATCATTGATCCTTCCTTTCTTCCCTTCCTGTGTTTAC
TGGTTGTTTTAGAATACACTCATCCCTGTCAGTATGATATCCCTCTATAC
TATTTTATGTAACGTAACGTCTTCAATTCCTAGCCAGTTTTGTGGCTGGG
TACACAGTGAACCGCCGCCGTTGTTTGACATGTGGGGAGTCGATAATATG
GATGTGCGAAGATAGCTACAGAATATACCGTAGTGGTTTACACC

Sequences in the Contig:

SY0AAA11YM24FM1 SY0AAA20YJ22FM1 SY0AAA20YJ22RM1
SY0AAA24YC23FM2 SY0AAA43YN02FM1 SY0AAB25YB22FM1
SY0AAB38YD19FM1 SY0AAB3YD19FM1 SY0AAB46YK24FM1
SY0AAB51YL24FM1 SY0AAB52YO14FM1 SY0AAC37YF21FM1
SY0AAD16YB06FM1 SY0AAD3YP14FM1 SY0AAD48YH14FM1
SY0AAD48YO20FM1 SY0AAD55YD05FM1 SY0AAD6YD11FM1