Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1175
Length(NT) : 1394
Best Gene Model Blast : Link to GSTUMT00009762001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: DNA-directed RNA polymerase II largest subunit
Accession: ref|XP_001542193.1| Score: 1488 E_value: 1e-163
KEGG Definition: RNA polymerase II, large subunit [EC:2.7.7.6]; K03006 DNA-directed RNA polymerase II subunit A
Accession: aor:AO090003000491 Score: 1427 E_value: 1e-156
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 1205 E_value: 1e-133
PFAM Definition: RNA_pol_Rpb1_5, RNA polymerase Rpb1, domain 5. RNA polymerases catalyse the DNA dependent polymerisation of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). This domain, domain 5, represents the discontinuous cleft domain that is required to from the central cleft or channel where the DNA is bound..
Pfam Number: pfam04998 Score: 679 E_value: 8e-72
Swissprot: P36594|RPB1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005665 = Cellular component: DNA-directed RNA polymerase II, core complex
GO:0003677 = Molecular function: DNA binding
GO:0003899 = Molecular function: DNA-directed RNA polymerase activity
GO:0005515 = Molecular function: protein binding
GO:0006366 = Biological process: transcription from RNA polymerase II promoter

Sequence:
>Contig1175
TTGGGCCGGCTACTCAGATGACGTTGAATACTTTCCATTTCGCTGGTGTG
TCGTCTAAGAATGTCACTCTTGGTGTTCCTCGGTTAAAGGAAATTCTCAA
CGTTGCCAAGAACATCAAGACTCCCTCTATGATGGTTTACCAGGTTCCAG
AAAATACCCACGAGAAGGAAACTGCGAAAGCACTTCGTTCAGCGGTCGAA
CATACAACCTTACGGTCAGTCACTGAGACCACTGAGATTTGGTACGACCC
TGATCCGAGGGATACTGTCATAGAAGAGGATAAGGAGACTGTTTTGTCAC
ACTTCTTGATTGACACAGACTCTGAGGATATCGACAGGCAGTCCAAATGG
CTTCTTCGAATTATCTTTGATAGAAAGAAGTTGCTTGATAAAGATTTGAC
GGTTGAGAGGGTAGGAATGAAGTTGATGGAAGAATATGGCAATGACATGG
CCATTATCATGAGTGATGATAACGCAGAAATTCCAAATATTAGATGTCGA
ATGAAGAATGCGGACCAAGCCAAATCTTTGGATGAGGAGAGTGATCTTGA
AGAAGACACCATGCTCAAACGTCTAGAGAATCACATCCTTGACGAATTAA
CCCTCAATGGCGTTAAGGGCATTCAGAGGGCGTTTTTGAACGATAAGGAG
CGCACAAGGATTGATGAGACTGGCAAGTTTGTAATGAGCAAGGAGGATCC
TAAGTGCAAGGAGTGGGTTTTGGATACCACTGGTACGGCACTGAAGCAGG
TACTCGAAGTTGAAGGGGTTGATACTACCAGAACCTACTCCAACACATTC
GAGGAAATCTTACAAGTTTTCGGAATCGAGGCTACTAGAGGTGCACTTCT
TCGAGAGTTAAGGCAGGTGTTGGCTTTCGATGGTTCTTATGTTAACGAAC
GACATCTTGCGCTTCTTTGCGATGTCATGACTTCGCGTGGACACCTGATG
GCCATCACTCGCCATGGCATTAATCGTGCAGACACCGGTGCGCTCATGAG
GTGTTCTTTTGAGGAGACTGTGGAAATCTTGTTGGAAGCAGCAGCCTCGG
GAGAATTGGATGATTGCAGGGGAATCTCTGAAAATGTTATGTTGGGACAA
TTGGCTCCTTTGGGGACAGGGGAATTCGACGTCTTCTTGGACGAAAAGAT
GTTGGCCGAGGTGATTGTTGACAATTCACGCGTTACCGGTGGAGAAATAC
CAGGCATGGGCAAGGGTGTTCTCGCGGACGGCGCCGCAACTCCTTACGAC
AGTTCCTCACCAATGTATGGTGACCCTTACGTGGGATCACCCGATGCCGG
TGCCGCGTTCTCGCCTATGCAACATACTGGCTCGGAGACGCCAGGTGGAT
TGACCGACTACCAAGCCCCTGGGTTCGGATCAAGCTACGGTGGT

Sequences in the Contig:

SY0AAA41YM21FM1 SY0AAA43YL20FM1 SY0AAC12YK10FM1
SY0AAC36YL14FM1 SY0AAC37YK06FM1 SY0AAC6YH02FM1
SY0AAD57YG13FM1