Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1174
Length(NT) : 760
Best Gene Model Blast : Link to GSTUMT00012037001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_06231
Accession: ref|XP_001796613.1| Score: 764 E_value: 2e-79
KEGG Definition: NADH-ubiquinone oxidoreductase, subunit F, putative [EC:1.6.5.3 1.6.99.3]; K03942 NADH dehydrogenase (ubiquinone) flavoprotein 1
Accession: afm:AFUA_4G11050 Score: 724 E_value: 4e-75
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2658 Score: 648 E_value: 1e-68
PFAM Definition: Complex1_51K, Respiratory-chain NADH dehydrogenase 51 Kd subunit..
Pfam Number: pfam01512 Score: 448 E_value: 2e-45
Swissprot: Q92406|NDUV1_ASPNG

Sequence:
>Contig1174
TTGGCGATTTCGGTCGTCGCACGATTGCCCGGAGAAAGGTTCACAATAAT
TAGAGGGCCGCCATCAAGACTCCTCCACCAGGAAACTCCCTCCCGAATTC
CCCCATCCTTCAATCCCTTCACTCAGCTGCCAATCAACTCTTCCGAAGCC
AAAATCACCGAACAATGTTTCTAGCGCGGAACCCGCAGTGCGGCGTGATA
GCTTTGGCGTCCTCTCACCTGGCCCGCTCCTCTGCTATCGCTGTTTATCG
CCAACAAGGCAGTCGTAACCTAGCTACTGTTAGCGACACACCGACGAGGT
CCTACGGAGGTTTGAAGGATCAAGATAGGATTTTCCAGAACCTCTACGGA
CACCATGGCACAGACCTTAAATCTGCTATGAAATATGGAGATTGGTATAA
GACAAAGGAGATTCTCTTGAAGGGGCATGACTGGATTATCGGGGAGATCA
AGACTTCCGGTCTTCGTGGGCGTGGTGGTGCTGGGTTTCCGTCGGGTATG
AAATGGTCATTCATGACCCCACCCGGATGGAACACGGGAACTACACCACG
GTACCTCGTCGTTAATGCTGATGAAGGGGAGCCCGGAACATGCAAAGATC
GTGAGATCATGCGTAAAGATCCTCACAAGTTGGTCGAGGGATGCTTGGTT
GCCGGAAGAGCTATGGAAGCCACGGCAGCTTACATTTACATCCGTGGCGA
GTTTTACCATGAGGCTACCGTCCTGCAGAGGGCTATTCAGGAAGCCTATT
CCGCCGGGTT

Sequences in the Contig:

SY0AAA43YL04FM1 SY0AAA63YI19FM1 SY0AAB53YO05FM1
SY0AAB7YP17FM1 SY0AAC33YK04FM1 SY0AAD4YD23FM1