Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1173
Length(NT) : 687
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1173
TGGACAAAAAAGTTGGCTTCCGCCTCGAGCATGGCCAGGCGGACTGAGCT
GGAGACGGAGGCAGGCCCGAGTACCATTCTGTGTGCTCGTACTTGTTATA
GTGAGAATCGGGCCCGTTTTACTTTTTCGCCTCTTCTCTCTCCCCTTGGG
TTGGCTTGGGGGTGCGGAAGTTGATGATGATGTGATCAGTCTTTGTTTCT
TGGGGGCTGGGTTAAGGGTCAGGAAGGTACTCGCACTCTGCTCGAGTACC
GGTATTGTGTCGTGTTTGAACTCGAGATCGGTATACGGACACTGTATGGT
AAGTGAGAAGGACCGCCCGCCGTGAACAATTTGGAGGATGGTTTACTTTA
CTGTGGCTGGACCCCTGTAGTACCGGTATGATACCTTATACTTCCGTCCT
TGCCTTGTTCCTAGAAATGATTTGGCTCTATGGATGAGCGGGTGGGCGAT
GAATGATGGGGGGAGGGGGCAGGGGGTTTCTTTCTTGTCCGCTTGTGGAT
CCGGGTTAGTGGGTGTGTGGTAAGGGTTGAGTGGTGTAAGCCATCTATGA
CACTATAGAAATGGCACATTACGCCCTTATTCCCCGTGTCTACCTTTTAT
TTCCATGGCTCTTGTCCTTCTTGTCTCCCTTTTGTTTGCCTCTTTCTTGA
AATTCAATTCTTTTCCCACTCGTTCCCTGGTCTTGAC

Sequences in the Contig:

SY0AAA14YD04FM1 SY0AAA15YH10FM1 SY0AAA28YI13FM1
SY0AAA3YE08FM1 SY0AAA43YK23FM1 SY0AAA53YM11FM1