Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1172
Length(NT) : 1025
Best Gene Model Blast : Link to GSTUMT00007241001 E-value : 1e-42
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein NCU05685
Accession: ref|XP_963047.2| Score: 139 E_value: 9e-07
KEGG Definition: hypothetical protein
Accession: fgr:FG02719.1 Score: 139 E_value: 5e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1172
TTGGACAGCTTCGCCCAAACCACGCAGACGCCGTCGAGTCCCACCGATTA
AAAAGGAACCCCGAAATGTGGATGAAAAAAGCATGAAAGAAAAAGAAAAA
AAATGAATGAATGAAAAAGGTATGATGATGATGATGATGATGATGATGAT
GGGACGTTGGAAAATATGATAGGTATTTAGGAGAAAGGAAGAGGGAGAGG
GAGAGGGGGGAAATAGTCAAGACTCGCTTCTCTTCACATCCACGGAAGAC
TACATCGAAATGATTTTTGGATGAAACGGAATCAAAAACCAAAAGACGAA
CGACACTCGTTTACCACCAATCTGACCAAACAAACAGAGGAAAGCAATCG
AAGGGGGAAAAAATGAGGGATAAAGCAAAGAAACAAAGAAAGCCCTTCAA
TATGCGCCGACACCATGTTCCCAACCGATCTCAACCCCGATGCTAAACCC
TTTACTTCCCGGCAAAATGCTCTTTTGCATACTGCTCGCAGGCCTATAAA
GTCCACTCGTTAGCCGGGACGAGTATCAAAAATACAACATACCTTTGCCG
GCTTCCCAACTTTAGTTCCGATGACCTTCCACTTGTTTGCTTCATATTCT
TTGATGGCAGCAAGCAAGGCAGCGCTCTTCGTTTTTGCGAGCCAGGAAAA
ATAAGTCAGCAAGATGAAAGGGACGAAAGGTTTGAGAAAAAGACATTTAT
TCCTTCTAGAGAAATGGGCGTTGGCGCCTCACTCACCTCATCTTCGCCAA
ACTCTGCATAATGCATATCCTACTTCTGTTAGCGGATGCTCTTCCTCGTT
GCATAAAAAGATAGCGCGGGACATCATATATATATATGCATATGTGTATA
TATGCATGTATATCTATAAAGGAAGAAATGGGGAGAAGGTGAAGGGGTGG
GAGAATAGAGAGAGCAAGGCGGGGGGGAAGTAGGTGAGCTCCAAACTTGC
CTTATACCAGTGCTTCTTTACACTACCTTCAGTCCTGGTTGGAAAGGTCT
TTGCGATCTCACTCCACGAGTTTCC

Sequences in the Contig:

SY0AAA43YK22FM1 SY0AAA60YJ06FM1 SY0AAB29YM04FM1
SY0AAB32YG14FM1