Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1171
Length(NT) : 709
Best Gene Model Blast : Link to GSTUMT00001101001 E-value : 2e-90
Numbers of ESTs : 3

Blast Results:

Nr Definition: ATP synthase subunit a (ATPase protein 6) emb|CAA31791.1| unnamed protein product
Accession: sp|P14862|ATP6_COCHE Score: 168 E_value: 2e-10
KEGG Definition: atp6; ATP synthase subunit 6
Accession: ang:Asnifp07 Score: 145 E_value: 5e-08
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG4665 Score: 208 E_value: 1e-17
PFAM Definition: ATP-synt_A, ATP synthase A chain..
Pfam Number: pfam00119 Score: 173 E_value: 1e-13
Swissprot: P14862|ATP6_COCHE
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>Contig1171
TTGGAATGCCTCTTCGTGGCTTACAGGACTAGTAAATTAAATTAATTTAA
ATTAATTTAATCAAAGCTAAATTTCTTTTTTATCTTTTTATCAAATAATT
ATTAAATAGGCTTAAATGCTTTCTTTCAAGAATATAACAAGTCCAATGGA
TCAGTTTGAGGTCAGAAATTTACTTAGTTTAGATGTACCATTGTTAGGTA
ATATTAATATGTCTATAACCAATATAGGGTTATATTTAATAATTGGTGTT
TTAATAGTATTATCTTTAAACCTTTTTTCTACTAATAACAATAAAATAGT
TTCTAATAACTGATCAATTTCCCAAGAATCAATCTATGCAACAATTCATA
GTATAGTTGTGAGTCAAATAAATGCAGCTAAAGGTCAGATCTACTTTCCT
TTTATTTACTCACTATTTATATTTATTCTAATTAATAATCTTTTAGGTAT
GGTAGAAGCGAGCCCATACGATAATATTGATAATATCTTTACGTTAAGTA
GTTTACTTATAAGCAACAAAAAGGGTTAAAGGTAATTCTTATTCTGTTAA
CTGTAAATATTCTACTAGCTCTTCTTATAATAATAATAGTAAGGGTAGCC
TTATTACCTTACTGGATTTATAGACGCTCTCGCTAAACAAACCTTTTATA
AGCATGCTTTACTCCTACTCACACAAGCATTGAATAAAAATAATTTTAGT
ACAGCGGTT

Sequences in the Contig:

SY0AAA38YN10FM1 SY0AAA43YK18FM1 SY0AAC11YF02FM1