Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1170
Length(NT) : 931
Best Gene Model Blast : Link to GSTUMT00000139001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1170
TTGGGTCGAAGAGAAGAGGGGAAGAAGGTAAAAAAAAAAAAACCGTGAGA
GAAAGGCCTGAGACCAATCTCCTCCTGACTGAACAGAAAGACTGACCTCG
GAGTCAGTCGCGAACGTGACAACTTGCTCGCTTCCTCTTATCCGTCTTTT
GGGGTAACGTCTTTGTATAAGACCTGCACTGTCTTCCCAACCCACGATTC
AACTGTCTCCATTCCAGAACAACTCCAAAACGTCCACTAATTCAATATGT
CGGATAACGAAGACTCCAAACAGTTTGCCAAGGAAAGGCCGATATCGACC
ATCGCGCGGTCCTTCTCCGCGCAACTGAACGACGCGTTCCTGATTGATGA
TACATTGGACCAGTTGTCCTCTACCGTCGAGCAAAAAAAGCTCTCGGTAA
CCTTCCACTCGAAAGAACTGGAAGAGTTGGAAGCGCGGATTCGCCGCGCT
GAAGCTCTCCTGGAGGAGAAGAAGAAACGCTTCTCCGAGCAGCTCCCCGG
CGAGCAACCCTCCGATCTATCAGCCCCCAGCACTCGCCCCGCTAGGCAGT
CAATGCCCGACCACGACCAACCGGAAAGCTCGCAGGCTGCGGCTGCTCCA
CCAAACAGACCTGCTCCTGCCCCGCCAGTTGCCAATGGTGGCAGCGCTAA
GGGTGAGTTCGTGGTGATTGAGAAATCGGCCAGCATGCCTGGCGAGTCGG
GGAATGGCCCCCCTGCTGCGGTGTTTGGTGAGCAATATTCTGCGAGACCG
CCACCGCCTGTTCCGACTTGACTATTCTTTATCATTGCTATTCCATGTCG
TGAGGAGCTTCCGTTGGGCTGTATAGGGTGGGGTGGTAGGGCTTGTCATG
GTTTCGGGTGTTATTGCTTGTTTTTTTTATATTTTACTCACTATTATTTT
CTAATATCTCTCTCCTTTCACCTCATCCTGT

Sequences in the Contig:

SY0AAA29YB16FM1 SY0AAA43YK07FM1 SY0AAB47YI12FM1
SY0AAC53YN23FM1