Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig117
Length(NT) : 1124
Best Gene Model Blast : Link to GSTUMT00011741001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein BC1G_14954
Accession: ref|XP_001546517.1| Score: 256 E_value: 3e-20
KEGG Definition: hypothetical protein
Accession: yli:YALI0E17941g Score: 248 E_value: 1e-19
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0566 Score: 118 E_value: 7e-07
PFAM Definition: Herpes_BLLF1, Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220. It is the most abundantly expressed glycoprotein in the viral envelope of the Herpesviruses and is the major antigen responsible for stimulating the production of neutralising antibodies in vivo..
Pfam Number: pfam05109 Score: 133 E_value: 1e-08

Sequence:
>Contig117
TTGGCCACACTCTCTACCCACTCAGAGTTGCCATTCCTTCTGCTCTCTTC
GTCTTTCGCGTTTTTTTCTTTCGTTGGTTGTATATCACTCCCTTCTTGGC
TATCCGTCACCCACAGTCCTTCGTATCGATATATCGCTAGTCGATTCGCA
CCACAATCCCTCTTTTTTTGAGAGCTAGTTTTTTTTGCTACCAAAAGATA
GTATATTGCAACAGCTTCCATCATGAAGGTTTCCAGCACCAGCATTTTGA
GCCTTGTGCTCGCATTGAACGGGGTTATGGCCTCTGCTCTTCAGGCCCGT
GGCTACGAGGTCGTCACTGTCACTGAACTCGCAACTGAGTATGTTCATGT
CACGTCAACCGCTTGGGTTGAGCCTGCACAAGACGCGCCAACTCCGATCC
CTACGACCGCTCCGGATTCACACGAGAAGAATAAGAATAACAATCATGTT
ACCACGGATACTCCTAGTACTACTTTGTCCATTCTATCTATGTCTGAATC
GTCTAGAACGACCATCTCCACCCCATCGAAGCCCCCGACCTCCACCCCAA
CTCCCCTTTCTTCCTCAATATCTGTGCCAACATCTACTCAAGAACCACCC
ACAACATTGCAAACATCGACTTTGCCCCCTACCACCCCTGTCTCGACTCC
CGCTGCCAAGGCCGAGCCGTCAACTACTGCCCCTGCTCCAGTTCCATCTG
TTCCGGCTGTGGGGACTCCCAATGTTGGCAGTAGCGGTGGGAGCGGCGAA
AACCATGTTGGAGATGCCACTTTCTATGCTCCCGGTTTGGGATCGTGCAG
TATTACCAGCACGGAGTCCCAGTATGTTGCGGCCCTCGCCGCTCCCTTGA
TGGACTCCCAGAAGACAGCCAACTCAAACAACAACCCCTTCTGCGGTAAG
ACGATCCTCGTCTCGTACAATGGAGGCCCTCAGATCCCTGTGACTGTTGT
CGATCGTTGCCCTGAATGCGGAACATATGATCTCGATCTCTCTCCTGCTG
CCTTCGAGGCCTGCGGAGCCAAGAAAGACCAAGGCAGGGTCAAAATGACT
TGGTGCTTCGCTTAAATGATCATATCATTTTCTCAAATTTTTATTGAGGG
GTGTTTTCCTTCTGGGTGGTGATT

Sequences in the Contig:

SY0AAA14YF13FM1 SY0AAA41YJ22FM1 SY0AAA60YJ07FM1
SY0AAB1YH17FM1 SY0AAB22YJ17FM1 SY0AAB34YE17FM1
SY0AAB8YO01FM1 SY0AAC3YO14FM1