Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1169
Length(NT) : 1796
Best Gene Model Blast : Link to GSTUMT00004702001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein FG09410.1
Accession: ref|XP_389586.1| Score: 360 E_value: 5e-32
KEGG Definition: hypothetical protein
Accession: fgr:FG09410.1 Score: 360 E_value: 2e-32
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2462 Score: 218 E_value: 3e-18
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 137 E_value: 7e-09
Swissprot: Q9UTA1|YL8J_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1169
TTGGCCCCCCATTACGTCCATTAGCCCTCTGTACCCCTTCCCTGGCCCCC
TTCGGTTTCCCTGCAAAAATAATAATAATACTGTCAATCAAGCCCGTCTT
CCTGCCCATCCTTTACCGCTACCTTACATTTGTGCTCGAAAGAAGCCAGG
GGTGTCGCTTCGATCCTTCCCTGGCAAATACCCGACGTTAACGATTGGCC
CCCTCGGTCTCGCATCACCATCCCGAACTTACAATCACACCCGTCGCCTG
GATTTCCTCACCCAGGAATTGGCGGTCCCATAAATACCCCCACGGCGTCC
TTTCTGAGAGGTCACCGTTGAGTCCACATTTTCCCGCATTTCCGAGAGGT
TGGGTTCAAGAGGCAACCATTCTCCACGTGCAGACCGTCATATATCCATC
CCTCATCACCTCAAACCCGCTTAGAGGATCTTTCGTCTCAACACTCCCGC
AGTCACACTCCCCCTTCCTCTCTCGCCTTTAAAACTGCTACCACCACCAC
CACTCTTCAACACCACCACCTACCATCTACCACCACCCAAATTCACATCC
ATTACCACTCATCCACGTAATGAATCTTCCCAGCCTTGTCCACCAGTCGC
GGCACCACAACCACTACCCGCAGTCTGCTCAGAGTAATGGACTTGATTTC
TCAGATCACCAGTCTCCTGCTCCATACCTACATCGTCCACATGAATACGC
TCACCCACCCGCGCCTCCTCCATCACCACCAGTAGAGGATAGCAATAAAT
GTTCTCTACCATCGATTTCAACACTGCTCGTATTCGCCGATGGAGGCCAA
CCAGGGGGAAATGGAATGGACAGAATGGAGAGGCAACAACGGTCTCCTCA
ATACCAGAGCCAGCCACTTCATAGTTCTGGGCCTACTCTTCCTCCCACCC
CTCCTATGAGACCTGACTCAGTTTTTGAGGGTAATAATTCGCCCACACTG
TCATCGACATCACCTTCATCTTCTTACTTCTACTCCCCTACTTCATCGCA
AGGAGGGAACCGAAATTCTTACCCTCCTGCGCAGTCAAAGTACCCGTCGC
CTCCTGAGACGTCCTATCTTCCTCAATACTCTTATTCACCATCCACTCCT
CAGAGCCAGCCTGCCATGGCATACACATCAAATCCTTGGCATCACCATCA
CCATTCATCACCCGCTTCACACGCTGCGTTTCCGCAATCGCAAGATCGTT
ACATCTGTCCGACATGCAACAAAGCATTTTCGAGACCCAGTAGTCTGAGA
ATACACAGTCACAGTCATACTGGCGAGAAACCCTTCAAATGCCCTCACCA
CGGATGCGGCAAGGCTTTCAGCGTACGGAGCAACATGAAGCGCCACGAGA
GAGGTTGCCATCAATAATAACAAAAATCAAGAAAGAATGACGACGACTAC
AAAAAGTCTGTTAATATACAAAAAAAAAAAAAAGGTGGTGCATGAACCGG
CGAACAAGAAGTTTCTGGGTAATTTTTAAATATTGGATGCTATTTCTTGT
TGTCCTTACAATTACCATTTTCCCCGGTCTGAGTGTTCACCGTACACCAG
GATCTTATTCGCGGGTCGACCAGCGCGGCGATACCCAATCATGCTTAGCG
TTTTGTAGATTATTCCCTTTTGTATCCTGTATCCTCTACTGTTTCTCTCT
GGGTCTTCACTTTTGTTTGCGGTCATTTTCTTACTAGCATTGCAAACTCT
ACGGCGCAATCTGGGTCTGATCTTGAATTATGCCATGTGTTTATGGCGAG
TACTGATTATGTTGGGTCTGTTTTGGGTACCAAAGTTTATTGTATC

Sequences in the Contig:

SY0AAA20YG12FM1 SY0AAA43YK05FM1 SY0AAA48YG15FM1
SY0AAA58YJ13FM1 SY0AAB10YG16FM1 SY0AAB37YK20FM1
SY0AAB39YO13FM1 SY0AAB43YL10FM1 SY0AAB44YF05FM1
SY0AAB49YL13FM1 SY0AAB52YL20FM1 SY0AAB53YO15FM1
SY0AAB54YN06FM1 SY0AAB58YD12FM1 SY0AAB59YB12FM1
SY0AAC54YF01FM1