Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1168
Length(NT) : 1853
Best Gene Model Blast : Link to GSTUMT00003498001 E-value : 0.0
Numbers of ESTs : 63

Blast Results:

Nr Definition: predicted protein
Accession: gb|EDR13949.1| Score: 933 E_value: 2e-98
KEGG Definition: hypothetical protein
Accession: ang:An01g05900 Score: 715 E_value: 2e-73
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0158 Score: 425 E_value: 3e-42
PFAM Definition: p450, Cytochrome P450. Cytochrome P450s are haem-thiolate proteins involved in the oxidative degradation of various compounds. They are particularly well known for their role in the degradation of environmental toxins and mutagens. They can be divided into 4 classes, according to the method by which electrons from NAD(P)H are delivered to the catalytic site. Sequence conservation is relatively low within the family - there are only 3 absolutely conserved residues - but their general topography and structural fold are highly conserved. The conserved core is composed of a coil termed the meander, a four-helix bundle, helices J and K, and two sets of beta-sheets. These constitute the haem-binding loop (with an absolutely conserved cysteine that serves as the 5th ligand for the haem iron), the proton-transfer groove and the absolutely conserved EXXR motif in helix K. While prokaryotic P450s are soluble proteins, most eukaryotic P450s are associated with microsomal membranes. their general enzymatic function is to catalyse regiospecific and stereospecific oxidation of non-activated hydrocarbons at physiological temperatures..
Pfam Number: pfam00067 Score: 504 E_value: 2e-51
Swissprot: Q12612|TRI4_FUSSP

Sequence:
>Contig1168
TTGGCGGGGTGGTATGCAGGGTATTGGGATTTATATCGGGGTGGGCAGAT
GGGGAACAGTTGGATGGTACCCCCGCACTTCAACTTTCTTTCCTGTCCGT
CCCTTGCTGTTAGTGTTAATACCGGTACTGCACTGCCTTACATGCATACC
AAATAGGTTCGGCACGTATATAACTTCGAGCTCTTTCGCTCAAAGTTAGC
CTTTAACCATTAGCAACACCTCAACATCAACGTCAACACCATCACCACTG
TCACCACCATGAGTATATTAAATATTGGGCTCGTTAGCTCGGCAGTTTAT
CTGCTCGGCGCGTGGATGGCGTACCTTGTCCTACTCATTTTCTATAGACT
CTCTCTACACCCGCTGCGACGCTTCCCCGGGCCAAAGATGGCAGCGGTGA
CGGGGTGGTATGCAGGGTATTGGGATTTATATCGGGGTGGGCAGATGGTG
AATCATTTGGTGGATTTGCACAAGGAATATGGTCCGATAGTCCGCTGCGA
GCCGAACCATCTCCACTTCTCCTCCCCAGAAGTCTACTCCACAATTTACA
ACGCCACCGGTAAACTTACCAAGGACCCAAACCTCTACCTCAGTTTCGGC
GCGAATGACTCAGTCTTCACGCTGGTGGATCCCACCATCGCGCGAACCCG
GCGAGAGGTGATCTCACCAATGTTCTCCCGGCGAATGGTGCTCTCGCTGC
AACCGCTTATTAGCGGAAAGTTCCGAAAGCTCTGTGGTAAATTCTCCAGC
TACGCGGACCGTGACGAGGCGGCGGATATGGCCTCTGGGTTCCGCAGCGC
GTCGATAGACATTATTACGCAGTATTGTTATGGCGAGTGTCTTGATTCCC
TGGATGTGGAGGGTTTCAAGCATGATATATTGCTGTCAATTAAAGCTACT
AGCAAGGCGTTCTGGGTGGTCAAGTACTTCCCCATGGACTGGATACTTAC
CTTGCCGGCCAATCTCACTTTACGACTAATGCCGGAACTAAAGGGGTTTT
TAGCTGTCAGAGACAACATAGAAGCACAGGTGAAGCGTTACATGAAAAAC
CCGAGCCTTCTCGAGAAATCCTCACACCCAACGGTATATCAACGCTTCCT
AGACCCAGATGTTAAAGGCGGAATCCCAAAGGCCAGTGCTCTCGCCGACG
AAGCTCAGAACTTGTTTTTCGCTGGGAGCGATACCGTTGGCACAACGCTG
GCTTTCGGAACGTACCATATCCTAACTACACCCGGGTTGCAAGAGAAGCT
GTTTGCAGAGATATGTCAGGTATGGCCGGTACTTGAAGAGGAACCTACGT
ATGATCAATTGGAGAAGTCGGCATATCTTACCGCTATCATAAAAGAAAGC
CTACGAATAAGCCACGGAGTCGTAACACCCCTAACTCGTGTAGTCCCCGC
TTCGGGCATGACAATCCAAGATCAGCCCATCCCCGACGGAACCGTCGTAT
CAATGGACGTGCCCACAGTCCACCTAAACCCAAATATATTCCCATCGCCG
AACACCTTTCTGCCAACCCGCTGGCTAGATTCCAACGCCAAGGATTTAGA
CAAGTATCTTGTGGCGTTTAGTAAAGGGTCACGAGCGTGTATTGGATCGA
ATCTCGCTTGGGCCGAGATGTATATCGGCTTCGCGGGAGTATTTCGCAGG
TTTGAGATGGCGGTTTGGGAGACTAGTAAGGAGGATATGGAATGGATGGA
TTGTTTCACGCCGATCACGAGGGGGGACTTGAAGGTGAAGTTTAAGGTCA
GAGGGGAGTAGTTAGGAAGACGAAGGAAATAGTTGTACAGTACTAGTCAC
TCTACTCATCTAATTTTCTTTTTCAACAACACGATTCATGGAATGTTCAA
GAT

Sequences in the Contig:

SY0AAA10YJ23FM1 SY0AAA11YF01FM1 SY0AAA12YD08FM1
SY0AAA17YL24FM1 SY0AAA18YF01FM1 SY0AAA18YF01RM1
SY0AAA19YE01FM1 SY0AAA19YH10FM1 SY0AAA20YC18RM1
SY0AAA20YI12RM1 SY0AAA22YP20FM1 SY0AAA33YO04FM1
SY0AAA3YD15FM1 SY0AAA43YC09FM1 SY0AAA43YK04FM1
SY0AAA44YA11FM1 SY0AAA45YB09FM1 SY0AAA48YM09FM1
SY0AAA50YA01FM1 SY0AAA53YP08FM1 SY0AAA57YP03FM1
SY0AAA58YB01FM1 SY0AAA58YD12FM1 SY0AAA58YH09FM1
SY0AAA59YL20FM1 SY0AAA60YK19FM1 SY0AAA61YB11FM1
SY0AAA7YC23FM1 SY0AAA7YG20FM1 SY0AAA8YP10FM1
SY0AAA9YJ18FM1 SY0AAB10YA13FM1 SY0AAB13YK10FM1
SY0AAB15YC04FM1 SY0AAB17YM22FM1 SY0AAB18YC08FM1
SY0AAB18YL21FM1 SY0AAB19YC04FM1 SY0AAB1YJ09FM1
SY0AAB1YL13FM1 SY0AAB23YE07FM1 SY0AAB25YB21FM1
SY0AAB26YC02FM1 SY0AAB31YH10FM1 SY0AAB35YP12FM1
SY0AAB41YD11FM1 SY0AAB42YF14FM1 SY0AAB43YI14FM1
SY0AAB44YK12FM1 SY0AAB50YF07FM1 SY0AAB52YF06FM1
SY0AAB56YG06FM1 SY0AAB56YL12FM1 SY0AAC20YA07FM1
SY0AAC21YF16FM1 SY0AAC37YK21FM1 SY0AAC38YL17FM1
SY0AAC53YA13FM1 SY0AAC55YM13FM3 SY0AAC56YF16FM1
SY0AAD53YE11FM1 SY0AAD61YK14FM1 SY0AAD6YK04FM1