Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1167
Length(NT) : 674
Best Gene Model Blast : Link to GSTUMT00003198001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_01015
Accession: ref|XP_001247244.1| Score: 534 E_value: 7e-53
KEGG Definition: IdgA domain protein [EC:2.7.1.-]; K00924
Accession: afm:AFUA_2G05800 Score: 517 E_value: 3e-51
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3009 Score: 444 E_value: 5e-45
PFAM Definition: Indigoidine_A, Indigoidine synthase A like protein. Indigoidine is a blue pigment synthesised by Erwinia chrysanthemi implicated in pathogenicity and protection from oxidative stress. IdgA is involved in indigoidine biosynthesis, but its specific function is unknown..
Pfam Number: pfam04227 Score: 536 E_value: 1e-55
Swissprot: P33025|YEIN_ECOLI

Sequence:
>Contig1167
TTGGCGCCATTTCCCACGAATCCACCCCATTCTTCCAGCCAGCTGCAATC
CCCGCAGCTATTCTAAAGCCCCAAAACTCAACAAATTCGTTCAAATCTCG
GAGGAGGTACGTGGGGCACTAACATCAAAGACCCCCGTCGTAGCATTAGA
GACAGCCATCTACACACATGGCTTCCCATACCCAGACAACGTGGACCTAG
CCATCAAAGTTGAAGCCGCCATACGCGAGGGCGGTGCTGTTCCCGCAACC
ATCGGGATCCTAGACGGGATCGCCCGTGTGGGATTTTCCCAGCCGGAACT
AGAGTGCCTAGCGTCTACCGCGGGACAGAAGACCACTGTTAAAGTGTCTC
GTCGAGATCTGCCGTTTGTCGTGGGGATGGTGTGCTTGCAACCCGGGAAC
CCTAACCCTGGATATACCGTGGCATGGCTAATTCAGCATTGGGTGGGACG
GTAGAGACATAAAACGGCGTACAACGGCGGGACAACGATTGCGGGGACTA
TGCTACTCGCCCATATGGCGGGTATTAAAGTATTTGCGACGGGAGGGCTG
GGGGGAGTGCATAGGGGGTATCCAAACCCAATGGATGTATCTGCGGACTT
GATGGAGTTGGGGAGGACAAATGTTGCGGTTATTTCTGCTGGCTCAAAGG
CTTTCTTGGACTTGGAGAACACCT

Sequences in the Contig:

SY0AAA43YK03FM1 SY0AAC2YF20FM1